ID: 1074687862

View in Genome Browser
Species Human (GRCh38)
Location 10:115976473-115976495
Sequence CAGTGTGTGCATCTTGCCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074687860_1074687862 15 Left 1074687860 10:115976435-115976457 CCTGACTTGGGTGGAACCAGCGA No data
Right 1074687862 10:115976473-115976495 CAGTGTGTGCATCTTGCCCTTGG No data
1074687859_1074687862 16 Left 1074687859 10:115976434-115976456 CCCTGACTTGGGTGGAACCAGCG No data
Right 1074687862 10:115976473-115976495 CAGTGTGTGCATCTTGCCCTTGG No data
1074687861_1074687862 -1 Left 1074687861 10:115976451-115976473 CCAGCGACTTCACTGCAGACTTC No data
Right 1074687862 10:115976473-115976495 CAGTGTGTGCATCTTGCCCTTGG No data
1074687858_1074687862 17 Left 1074687858 10:115976433-115976455 CCCCTGACTTGGGTGGAACCAGC No data
Right 1074687862 10:115976473-115976495 CAGTGTGTGCATCTTGCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074687862 Original CRISPR CAGTGTGTGCATCTTGCCCT TGG Intergenic
No off target data available for this crispr