ID: 1074688094

View in Genome Browser
Species Human (GRCh38)
Location 10:115978227-115978249
Sequence GAACAGCCTTAGAATTATAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074688090_1074688094 20 Left 1074688090 10:115978184-115978206 CCTAGGGTGGCTCTTTAACGATG No data
Right 1074688094 10:115978227-115978249 GAACAGCCTTAGAATTATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074688094 Original CRISPR GAACAGCCTTAGAATTATAA AGG Intergenic
No off target data available for this crispr