ID: 1074692855

View in Genome Browser
Species Human (GRCh38)
Location 10:116022355-116022377
Sequence CTTTGTATCCTAAAGGTGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074692855_1074692861 -10 Left 1074692855 10:116022355-116022377 CCTGCCACCTTTAGGATACAAAG No data
Right 1074692861 10:116022368-116022390 GGATACAAAGCACCCTTTGGGGG No data
1074692855_1074692864 9 Left 1074692855 10:116022355-116022377 CCTGCCACCTTTAGGATACAAAG No data
Right 1074692864 10:116022387-116022409 GGGGATCACAGCCCTATGTCTGG No data
1074692855_1074692866 13 Left 1074692855 10:116022355-116022377 CCTGCCACCTTTAGGATACAAAG No data
Right 1074692866 10:116022391-116022413 ATCACAGCCCTATGTCTGGTGGG No data
1074692855_1074692865 12 Left 1074692855 10:116022355-116022377 CCTGCCACCTTTAGGATACAAAG No data
Right 1074692865 10:116022390-116022412 GATCACAGCCCTATGTCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074692855 Original CRISPR CTTTGTATCCTAAAGGTGGC AGG (reversed) Intergenic
No off target data available for this crispr