ID: 1074696132

View in Genome Browser
Species Human (GRCh38)
Location 10:116051550-116051572
Sequence CTGTCTGACCAGTGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074696132_1074696143 26 Left 1074696132 10:116051550-116051572 CCCCTCTGCCACTGGTCAGACAG No data
Right 1074696143 10:116051599-116051621 CCAGCTCCCCACCCACCAGCGGG No data
1074696132_1074696138 -6 Left 1074696132 10:116051550-116051572 CCCCTCTGCCACTGGTCAGACAG No data
Right 1074696138 10:116051567-116051589 AGACAGACACATCCTGGAATGGG No data
1074696132_1074696144 27 Left 1074696132 10:116051550-116051572 CCCCTCTGCCACTGGTCAGACAG No data
Right 1074696144 10:116051600-116051622 CAGCTCCCCACCCACCAGCGGGG No data
1074696132_1074696139 -5 Left 1074696132 10:116051550-116051572 CCCCTCTGCCACTGGTCAGACAG No data
Right 1074696139 10:116051568-116051590 GACAGACACATCCTGGAATGGGG No data
1074696132_1074696137 -7 Left 1074696132 10:116051550-116051572 CCCCTCTGCCACTGGTCAGACAG No data
Right 1074696137 10:116051566-116051588 CAGACAGACACATCCTGGAATGG No data
1074696132_1074696145 28 Left 1074696132 10:116051550-116051572 CCCCTCTGCCACTGGTCAGACAG No data
Right 1074696145 10:116051601-116051623 AGCTCCCCACCCACCAGCGGGGG No data
1074696132_1074696141 25 Left 1074696132 10:116051550-116051572 CCCCTCTGCCACTGGTCAGACAG No data
Right 1074696141 10:116051598-116051620 ACCAGCTCCCCACCCACCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074696132 Original CRISPR CTGTCTGACCAGTGGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr