ID: 1074696137

View in Genome Browser
Species Human (GRCh38)
Location 10:116051566-116051588
Sequence CAGACAGACACATCCTGGAA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074696134_1074696137 -9 Left 1074696134 10:116051552-116051574 CCTCTGCCACTGGTCAGACAGAC No data
Right 1074696137 10:116051566-116051588 CAGACAGACACATCCTGGAATGG No data
1074696130_1074696137 8 Left 1074696130 10:116051535-116051557 CCTGGACTGCGGGGTCCCCTCTG No data
Right 1074696137 10:116051566-116051588 CAGACAGACACATCCTGGAATGG No data
1074696132_1074696137 -7 Left 1074696132 10:116051550-116051572 CCCCTCTGCCACTGGTCAGACAG No data
Right 1074696137 10:116051566-116051588 CAGACAGACACATCCTGGAATGG No data
1074696133_1074696137 -8 Left 1074696133 10:116051551-116051573 CCCTCTGCCACTGGTCAGACAGA No data
Right 1074696137 10:116051566-116051588 CAGACAGACACATCCTGGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074696137 Original CRISPR CAGACAGACACATCCTGGAA TGG Intergenic
No off target data available for this crispr