ID: 1074696141

View in Genome Browser
Species Human (GRCh38)
Location 10:116051598-116051620
Sequence ACCAGCTCCCCACCCACCAG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074696132_1074696141 25 Left 1074696132 10:116051550-116051572 CCCCTCTGCCACTGGTCAGACAG No data
Right 1074696141 10:116051598-116051620 ACCAGCTCCCCACCCACCAGCGG No data
1074696135_1074696141 17 Left 1074696135 10:116051558-116051580 CCACTGGTCAGACAGACACATCC No data
Right 1074696141 10:116051598-116051620 ACCAGCTCCCCACCCACCAGCGG No data
1074696133_1074696141 24 Left 1074696133 10:116051551-116051573 CCCTCTGCCACTGGTCAGACAGA No data
Right 1074696141 10:116051598-116051620 ACCAGCTCCCCACCCACCAGCGG No data
1074696134_1074696141 23 Left 1074696134 10:116051552-116051574 CCTCTGCCACTGGTCAGACAGAC No data
Right 1074696141 10:116051598-116051620 ACCAGCTCCCCACCCACCAGCGG No data
1074696140_1074696141 -4 Left 1074696140 10:116051579-116051601 CCTGGAATGGGGATGATCAACCA No data
Right 1074696141 10:116051598-116051620 ACCAGCTCCCCACCCACCAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074696141 Original CRISPR ACCAGCTCCCCACCCACCAG CGG Intergenic
No off target data available for this crispr