ID: 1074696636

View in Genome Browser
Species Human (GRCh38)
Location 10:116055721-116055743
Sequence CTGTCAGCACAGATGGTGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074696636_1074696646 9 Left 1074696636 10:116055721-116055743 CCCCGCACCATCTGTGCTGACAG No data
Right 1074696646 10:116055753-116055775 ATTTCTCCGGGAATGAACTTGGG No data
1074696636_1074696647 10 Left 1074696636 10:116055721-116055743 CCCCGCACCATCTGTGCTGACAG No data
Right 1074696647 10:116055754-116055776 TTTCTCCGGGAATGAACTTGGGG No data
1074696636_1074696645 8 Left 1074696636 10:116055721-116055743 CCCCGCACCATCTGTGCTGACAG No data
Right 1074696645 10:116055752-116055774 CATTTCTCCGGGAATGAACTTGG No data
1074696636_1074696649 23 Left 1074696636 10:116055721-116055743 CCCCGCACCATCTGTGCTGACAG No data
Right 1074696649 10:116055767-116055789 GAACTTGGGGATTTCTGCAAAGG No data
1074696636_1074696643 -4 Left 1074696636 10:116055721-116055743 CCCCGCACCATCTGTGCTGACAG No data
Right 1074696643 10:116055740-116055762 ACAGCTGGGGTTCATTTCTCCGG No data
1074696636_1074696644 -3 Left 1074696636 10:116055721-116055743 CCCCGCACCATCTGTGCTGACAG No data
Right 1074696644 10:116055741-116055763 CAGCTGGGGTTCATTTCTCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074696636 Original CRISPR CTGTCAGCACAGATGGTGCG GGG (reversed) Intergenic
No off target data available for this crispr