ID: 1074700517

View in Genome Browser
Species Human (GRCh38)
Location 10:116088090-116088112
Sequence ATGGAGAACCAGAAGGACAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074700512_1074700517 25 Left 1074700512 10:116088042-116088064 CCTTAGTGTTTTCTGTGTGTGAG 0: 1
1: 0
2: 2
3: 37
4: 379
Right 1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG No data
1074700511_1074700517 30 Left 1074700511 10:116088037-116088059 CCTCTCCTTAGTGTTTTCTGTGT No data
Right 1074700517 10:116088090-116088112 ATGGAGAACCAGAAGGACAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074700517 Original CRISPR ATGGAGAACCAGAAGGACAA AGG Intronic
No off target data available for this crispr