ID: 1074701195

View in Genome Browser
Species Human (GRCh38)
Location 10:116094181-116094203
Sequence CTTCATAAATAGATAGAGCC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074701193_1074701195 6 Left 1074701193 10:116094152-116094174 CCTTGCATTTTCTTGAAAATGTC No data
Right 1074701195 10:116094181-116094203 CTTCATAAATAGATAGAGCCGGG No data
1074701191_1074701195 13 Left 1074701191 10:116094145-116094167 CCAAATCCCTTGCATTTTCTTGA 0: 1
1: 0
2: 1
3: 40
4: 391
Right 1074701195 10:116094181-116094203 CTTCATAAATAGATAGAGCCGGG No data
1074701192_1074701195 7 Left 1074701192 10:116094151-116094173 CCCTTGCATTTTCTTGAAAATGT 0: 1
1: 1
2: 7
3: 117
4: 1037
Right 1074701195 10:116094181-116094203 CTTCATAAATAGATAGAGCCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074701195 Original CRISPR CTTCATAAATAGATAGAGCC GGG Intronic
No off target data available for this crispr