ID: 1074702834

View in Genome Browser
Species Human (GRCh38)
Location 10:116107433-116107455
Sequence TTTAAGGTCTTCATGTGTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074702829_1074702834 0 Left 1074702829 10:116107410-116107432 CCTAAGGACAATTGATCCCCTTT 0: 1
1: 0
2: 1
3: 16
4: 106
Right 1074702834 10:116107433-116107455 TTTAAGGTCTTCATGTGTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074702834 Original CRISPR TTTAAGGTCTTCATGTGTTC AGG Intronic
No off target data available for this crispr