ID: 1074705767

View in Genome Browser
Species Human (GRCh38)
Location 10:116128871-116128893
Sequence CTTTGTACAAAGTTGGAACA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074705763_1074705767 19 Left 1074705763 10:116128829-116128851 CCTCTTAATGTTATTAGAAAAGC 0: 1
1: 0
2: 1
3: 16
4: 235
Right 1074705767 10:116128871-116128893 CTTTGTACAAAGTTGGAACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074705767 Original CRISPR CTTTGTACAAAGTTGGAACA GGG Intronic
No off target data available for this crispr