ID: 1074710418

View in Genome Browser
Species Human (GRCh38)
Location 10:116172685-116172707
Sequence ATGTGTAAGTGGAAAGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074710414_1074710418 -2 Left 1074710414 10:116172664-116172686 CCGACTGGCTGGGGGACGGGCAT 0: 1
1: 0
2: 0
3: 17
4: 134
Right 1074710418 10:116172685-116172707 ATGTGTAAGTGGAAAGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074710418 Original CRISPR ATGTGTAAGTGGAAAGTGGA GGG Intronic
No off target data available for this crispr