ID: 1074721627

View in Genome Browser
Species Human (GRCh38)
Location 10:116270610-116270632
Sequence TGGAAAACCCATGAGGAGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 254
Summary {0: 1, 1: 0, 2: 1, 3: 23, 4: 229}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074721627_1074721632 -1 Left 1074721627 10:116270610-116270632 CCGTCCTCCTCATGGGTTTTCCA 0: 1
1: 0
2: 1
3: 23
4: 229
Right 1074721632 10:116270632-116270654 AACAACAGGCCCAACAATGCTGG 0: 1
1: 0
2: 1
3: 6
4: 99

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074721627 Original CRISPR TGGAAAACCCATGAGGAGGA CGG (reversed) Intronic
901917355 1:12510057-12510079 TGGAAACCCCAGGATGAGAAGGG + Exonic
902724124 1:18323897-18323919 GCGAAAACACATAAGGAGGAAGG + Intronic
903332963 1:22606355-22606377 TGGCCACCCCATGGGGAGGATGG + Intergenic
904260873 1:29286966-29286988 TGCAAAAGCCCTGAGGAGCACGG - Intronic
906732944 1:48098866-48098888 TGGAAATCCAGTGAGGAGGGAGG - Intergenic
906896155 1:49774377-49774399 TGCAAAACCCCTGTGGAGCATGG - Intronic
907533357 1:55124768-55124790 TTGAAAGCCCTTGAGCAGGATGG - Intronic
913712819 1:121503139-121503161 TGGAAAGCCCGTGAGAAGTATGG + Intergenic
916134838 1:161642388-161642410 TGGAAAATGCATGAAGAGCAAGG + Intronic
916675961 1:167064756-167064778 TGCAAAGCACAGGAGGAGGATGG - Intronic
917514203 1:175693527-175693549 TGGGAAACCTAAGAGGAGGGAGG - Intronic
918098149 1:181351163-181351185 TGGGAATACCTTGAGGAGGACGG + Intergenic
920681222 1:208074293-208074315 TGGAAAGCCCATGAGATGGCTGG - Intronic
921255808 1:213338295-213338317 TGGAGAAGCCAAGAGCAGGAGGG - Intergenic
1063069837 10:2649858-2649880 AGGGAAACCCATGAAAAGGATGG - Intergenic
1063525778 10:6783584-6783606 TGCCAAACACTTGAGGAGGATGG + Intergenic
1064490796 10:15854276-15854298 TGGAAAAGGCATGAGAAGTATGG - Intronic
1067226119 10:44376824-44376846 AGGAGAACCAAGGAGGAGGAGGG + Intronic
1067324659 10:45255981-45256003 TGGCAGACACAGGAGGAGGATGG + Intergenic
1068597999 10:58924669-58924691 TTGAAATCCCTGGAGGAGGAGGG + Intergenic
1070391519 10:75974945-75974967 TTAAAAACCAATGAGGAAGATGG + Intronic
1071991180 10:91102127-91102149 GGGAAAACCTATAAGAAGGAGGG - Intergenic
1072528375 10:96295093-96295115 AGGAAAATCCAAGAGGAGGCTGG - Intergenic
1073152112 10:101319117-101319139 TGGAAAGCCCATGAGTAGAAGGG + Intergenic
1074395850 10:113097354-113097376 AGAAGAACCCATGAGGAGGCCGG + Intronic
1074721627 10:116270610-116270632 TGGAAAACCCATGAGGAGGACGG - Intronic
1075621964 10:123934634-123934656 TGTAAACCCCAAGAGAAGGAAGG + Intronic
1076519143 10:131069029-131069051 CGGAAAACCCAAGAGAAAGAAGG + Intergenic
1076626567 10:131824675-131824697 GTGAAGACCCCTGAGGAGGAGGG + Intergenic
1077698515 11:4418097-4418119 TGGAAAACCAGTGAGGAGGAAGG - Intergenic
1077699982 11:4432218-4432240 TGGAATTCCCATGAGCAGAAAGG + Intergenic
1077716539 11:4586934-4586956 TGGGATACCCACAAGGAGGAAGG - Exonic
1077717231 11:4594082-4594104 TGGGATACCCACAAGGAGGAAGG - Exonic
1079770832 11:24457512-24457534 TAGAAAACACAAGAGGAGAAGGG - Intergenic
1079951011 11:26804468-26804490 TGGACAATCCATGGGGAGTAAGG - Intergenic
1080904762 11:36531663-36531685 TAGAAAACGCAAGAGGAGAAGGG + Intronic
1082783318 11:57302930-57302952 TGGAAAAAGCATGGGAAGGAGGG - Intronic
1086568170 11:88250699-88250721 TGGAAACCCCAGGAAGAGGAGGG + Intergenic
1089287097 11:117414576-117414598 GCTAAAACCCATGAAGAGGAGGG - Intergenic
1089483000 11:118822287-118822309 TGGAAAAGACAAGAGAAGGAGGG - Intergenic
1090386719 11:126361602-126361624 TGGAGAACGCAGGGGGAGGAAGG - Intronic
1090522900 11:127497904-127497926 TGGAAATTCCATGAGGATGGGGG + Intergenic
1091644673 12:2264616-2264638 TAAAAAACCCATGTGGAAGAGGG - Intronic
1092481241 12:8860985-8861007 AGGAATACGCATGAGAAGGAGGG - Intronic
1092782487 12:11999906-11999928 TGGGAAACTCAAGAAGAGGATGG - Intergenic
1096308349 12:50498706-50498728 TGGAACACCCATGGGAATGAGGG - Intergenic
1100153668 12:91772101-91772123 TGGAAAACCTTTGAGTAGAATGG + Intergenic
1100822159 12:98441676-98441698 TGGAAGACCAATGAAGAGGGAGG + Intergenic
1100971506 12:100075941-100075963 TGGAGACCCCAAAAGGAGGATGG + Intronic
1102988384 12:117297202-117297224 AGAGAGACCCATGAGGAGGATGG + Intronic
1103267695 12:119644773-119644795 TTGAAAAGCTATGAGGAGGCTGG - Intergenic
1108465838 13:50714700-50714722 GGGAAAACACATGAGAAGGGAGG - Intronic
1109199091 13:59410996-59411018 TTGAAAACCCAAGAGGTGGTTGG + Intergenic
1111076064 13:83237120-83237142 GGGAAAACCCAAGATGAGAAAGG - Intergenic
1115001238 14:28421824-28421846 TGGAAAATCAATGAGGCTGAGGG + Intergenic
1115119824 14:29926967-29926989 TGGAAATGTCATGAGAAGGATGG + Intronic
1115711117 14:36051890-36051912 TAGCAAACCCATGAGTAGAAAGG + Intergenic
1115914636 14:38298279-38298301 TGGAATAACCAGGAAGAGGATGG + Intergenic
1121132157 14:91458254-91458276 TGGAAAACCTCTGTGGGGGAGGG - Exonic
1122342309 14:101036502-101036524 TGGCAAATACGTGAGGAGGATGG + Intergenic
1122513513 14:102289454-102289476 AGGAAAACCCGAGAGCAGGAGGG - Intronic
1123871633 15:24581081-24581103 TGGATAAGCCAGGAGGAGCAGGG + Intergenic
1124369590 15:29096301-29096323 TGGAAAACCCATCAGTAACAGGG - Intronic
1124657200 15:31518002-31518024 TGGACACCCCATCTGGAGGAGGG - Intronic
1126740456 15:51771839-51771861 TGGGAAACAAATTAGGAGGATGG - Intronic
1127364171 15:58271900-58271922 TGGAAAGACCAGCAGGAGGAAGG + Intronic
1127784954 15:62347692-62347714 TGGAAACTGCATGAGGAGGCTGG + Intergenic
1127847870 15:62887267-62887289 TGGAAAAGAGATGAGGAGAAGGG + Intergenic
1130520435 15:84657460-84657482 TGGAAGCACCAAGAGGAGGAAGG - Intronic
1132678461 16:1130292-1130314 GGGACAACCCATGTGGAGGCTGG + Intergenic
1133727980 16:8555029-8555051 GGGAAACCCCATGAGTGGGAAGG - Intergenic
1135185871 16:20315382-20315404 CTGTAAACCCATGAGTAGGATGG + Intronic
1137381669 16:48004978-48005000 TGGAAAAGCAATGGGGAGGAGGG + Intergenic
1139431296 16:66912323-66912345 GGCAAAATCCATGAGGCGGAAGG + Exonic
1139764643 16:69216897-69216919 TGCAAAGCCCATGAGTGGGAAGG + Intronic
1142173333 16:88634074-88634096 GGGAAAACCCATGAGGGGGTGGG + Intergenic
1142660129 17:1423185-1423207 TGGAAAACCGATGGACAGGAAGG - Exonic
1143689294 17:8547339-8547361 TGGAAAAGCCATACGGAGGATGG + Intronic
1144059521 17:11570171-11570193 TGGTGAACACAGGAGGAGGAAGG + Intergenic
1144084440 17:11796271-11796293 AGGAAAACACATGAGGATGGAGG - Intronic
1144336704 17:14277955-14277977 AGGAAGACACATGAGGAGGCAGG + Intergenic
1144495134 17:15741159-15741181 TGGCAGACACAGGAGGAGGATGG - Exonic
1144762425 17:17714929-17714951 TGGGAAGTCCATGAGGTGGAAGG - Intronic
1145251331 17:21298411-21298433 AGGAAAATCCAAGAGGAAGAAGG + Exonic
1145944725 17:28764813-28764835 GGGAAAAGCCATTTGGAGGACGG - Intronic
1146000230 17:29126374-29126396 TGGAGAACCCATAAGCAGGTGGG - Intronic
1147158141 17:38555376-38555398 TGGAAAACACATGTTGAAGACGG + Intronic
1147589982 17:41676509-41676531 TGGAAAGCCCCTAAGGAGGGGGG + Intergenic
1148236552 17:45973019-45973041 TTGAAACTCCATGGGGAGGATGG - Intronic
1148532583 17:48408975-48408997 TGGAAAACCCATCAGGTTGATGG - Intronic
1151400272 17:73851363-73851385 TGGAAAATTCAGGAGGAAGAAGG + Intergenic
1151586324 17:75010908-75010930 TAGAAAACCAAGGAGGAGAAAGG + Intergenic
1151730819 17:75910147-75910169 GGGCAAGCCCAGGAGGAGGAGGG + Intronic
1152040326 17:77898782-77898804 TGGAAAACCCATCAGTGGGCAGG - Intergenic
1152370171 17:79882699-79882721 TGGGAAGACCATGAGGATGAAGG + Intergenic
1157441612 18:47716011-47716033 TGGAAAACTGATGACAAGGAGGG + Intergenic
1158146628 18:54321887-54321909 TGAAAAACCTGTGAGGAGGATGG - Intergenic
1159557391 18:69959714-69959736 TGCTAAAACCATGAGGTGGAAGG + Intronic
1160273733 18:77411048-77411070 TGGAAAACACATGTGAAGGCTGG - Intergenic
1161735782 19:5991385-5991407 TGGAAGCCCCATGATAAGGATGG - Intergenic
1163177171 19:15572466-15572488 TGGGGAAGGCATGAGGAGGATGG + Intergenic
1165121975 19:33565906-33565928 TGGAAATCCAATCAGGAGGATGG + Intergenic
1165589036 19:36949918-36949940 TGGAAAAGCCTTCAGTAGGAAGG + Exonic
1166286991 19:41837308-41837330 AGCACACCCCATGAGGAGGAAGG + Exonic
925272237 2:2620123-2620145 TGGAAAACTCATGTGGTGAAAGG + Intergenic
926221869 2:10941704-10941726 AGGGAAACCCAGGAGAAGGATGG + Intergenic
926452158 2:13018445-13018467 AAGAAAACCATTGAGGAGGAAGG + Intergenic
928367359 2:30713102-30713124 GGGGAAAACCATGAGGAGTAAGG + Intergenic
929454901 2:42058685-42058707 TGGAAGACCCAGCAGGAGGTGGG - Intergenic
931376578 2:61713495-61713517 TCGAAAAGGCAGGAGGAGGAAGG + Intergenic
934157404 2:89216418-89216440 TGTAAAACCCATGGGTAGGGAGG - Intergenic
934209915 2:89966325-89966347 TGTAAAACCCATGGGTAGGGAGG + Intergenic
935490812 2:103717459-103717481 TGGAAAGCCCATGGGGACCAGGG + Intergenic
936242804 2:110802477-110802499 AGGGAAACCCATGGGGAGGTGGG - Intronic
937532669 2:122847810-122847832 GGAAAAACCCATGGAGAGGAAGG + Intergenic
939588477 2:144033723-144033745 TGGAAAGCCCCTAAGGAGGAGGG - Intronic
939856009 2:147359459-147359481 TGGAAACCCTATGGGGAAGATGG + Intergenic
940815571 2:158293905-158293927 TGGAAAACCAATGAGGGGCATGG + Intronic
940895030 2:159073211-159073233 TGGAAAAGCTATGAAGAGGTCGG - Intronic
940912288 2:159219193-159219215 TGGAAAATGCAGCAGGAGGATGG + Intronic
940982569 2:160019982-160020004 TGGAAGGCCCATGAGGAACAGGG + Intronic
941120500 2:161524473-161524495 TAGAAAACTCAAGAGGAGAAGGG + Intronic
945657210 2:212639464-212639486 TGGAAAAGTCATGAAGAAGAAGG - Intergenic
946875853 2:224129184-224129206 AGAAAAACCCAAAAGGAGGATGG - Intergenic
947331372 2:229032970-229032992 TGGAAAACTCATGAGTTGGAAGG - Intronic
948308121 2:236965077-236965099 AGGAAAACCCAGGAACAGGAAGG + Intergenic
1172081546 20:32345076-32345098 TGCAAAACCCAGAAGGAGCATGG + Intergenic
1173640872 20:44601090-44601112 TGGAAGTCCCATGAAGAGAATGG + Intronic
1175122070 20:56723504-56723526 TGGAAAACCAATGAGGCCGTAGG - Intergenic
1175706980 20:61186667-61186689 TGGAAAAGGCAGGAGGATGAGGG - Intergenic
1175829829 20:61957560-61957582 TGGAGAATCAAAGAGGAGGAGGG + Intronic
1176923388 21:14717166-14717188 TTTAAAACTCATGAGGAGGCTGG - Intergenic
1181284805 22:21744121-21744143 TGGAAAGCCCATTAGGAAGCAGG + Intergenic
1181337897 22:22154708-22154730 CAGAAAACCCATGAGGGGGATGG + Intergenic
1182466450 22:30519848-30519870 TGGAAAACACCTGATGAGGCAGG + Intergenic
1183228459 22:36566020-36566042 AAGTAAACCCATGAGGAGGCTGG - Intronic
1183684987 22:39356598-39356620 AGGAGAAGCCAGGAGGAGGAGGG + Intronic
1185206724 22:49543399-49543421 TGAAAGACCCATGGAGAGGAAGG + Intronic
949265635 3:2153313-2153335 GGAGCAACCCATGAGGAGGAAGG + Intronic
951466896 3:23010710-23010732 TGGTAAACCCATGAATAAGAGGG - Intergenic
952469463 3:33630909-33630931 TGTAAAACACAAAAGGAGGAAGG + Intronic
953138156 3:40201613-40201635 TGGAGAACCCATCATGTGGAAGG - Intronic
954568405 3:51619574-51619596 TGGAAAGGCCATGAGGAGACCGG - Intronic
955091711 3:55758476-55758498 GGGCAGACCAATGAGGAGGAGGG + Intronic
955484768 3:59424335-59424357 TGGAAATCCCATCAGAACGAGGG - Intergenic
956367988 3:68525940-68525962 TGGAAAACTCAGGAGGACTAAGG - Intronic
956639353 3:71400910-71400932 AGGAGAACACATAAGGAGGAGGG + Intronic
956652551 3:71518621-71518643 TGGAAAACACATGCAGAAGATGG + Intronic
956665244 3:71636287-71636309 TGGAAAACCCATGTAGAATATGG + Intergenic
960036772 3:113109973-113109995 TGGAAAAGAGAAGAGGAGGAGGG + Intergenic
960173966 3:114495725-114495747 AGGAAAAGAAATGAGGAGGAAGG + Intronic
960428401 3:117537397-117537419 TGAAAATCCCATGAGGGAGAAGG + Intergenic
960526318 3:118715094-118715116 TGGAAAAACAAGGAGGAGAAAGG - Intergenic
961009199 3:123424664-123424686 AGGAGAAGCCATCAGGAGGACGG - Intronic
963506481 3:146191277-146191299 TGGAAAACCCATAAGAAGTCTGG - Intergenic
965485531 3:169273791-169273813 TTGGAAACCCTTGAAGAGGATGG + Intronic
966828976 3:183989677-183989699 GGAAAAACAGATGAGGAGGACGG - Intronic
968177894 3:196567346-196567368 TGAAAAAGACATGAGGAGAAGGG + Intronic
968428372 4:537750-537772 TGGAGAAGCCAAGAGGAGGATGG + Intronic
969271495 4:6106192-6106214 TGGAAACCCCCTGAGGATGCTGG + Intronic
969321821 4:6417200-6417222 TGCAGACCCCACGAGGAGGAGGG + Intronic
974232727 4:59137519-59137541 TAGAAAACCCATGTGGTAGAAGG - Intergenic
975390610 4:73812893-73812915 TGGAAGCCCCATGAGGACAAAGG - Intergenic
976108523 4:81645095-81645117 TGGAATACCTATGAGGAGTATGG + Intronic
978419865 4:108519857-108519879 TGAAACACTCATGAGAAGGAGGG + Intergenic
979306269 4:119147876-119147898 TAGAAAGCCCAAGAGGAGAAGGG + Intronic
979986934 4:127326737-127326759 TGGAAATACTATGAGGAAGATGG - Intergenic
982351489 4:154420411-154420433 TGGAAAACCAAGGAAGAGAATGG + Intronic
983645157 4:169982076-169982098 TAGAAAACCCTTGAGAAGCAGGG - Intergenic
984644555 4:182205556-182205578 GGGAGCACCCATGAGGAGAAAGG - Intronic
985025367 4:185734633-185734655 TGGAAAAGCAAGGAGGAGGTGGG - Intronic
985935171 5:3092070-3092092 TTGAAAACCCATTAGGGGGCTGG - Intergenic
986383718 5:7210617-7210639 GGGAAAACCCTTGTGGAGAATGG + Intergenic
986607131 5:9533859-9533881 TTAAAAACCCATGAGGAAGGGGG - Intronic
988208949 5:28177614-28177636 TGGGAGAGGCATGAGGAGGAGGG - Intergenic
991475103 5:67010719-67010741 TGGAAATCCCAGGAGGAAAATGG + Intronic
991918828 5:71633054-71633076 TGGGAAACAATTGAGGAGGAGGG + Intronic
992039040 5:72810235-72810257 TAGAAAACTCAAGAGGAGAAGGG + Intergenic
992133645 5:73720549-73720571 GGGAAAATGCAAGAGGAGGAAGG + Intronic
995017735 5:107330774-107330796 TGGAAATTACATGATGAGGAGGG - Intergenic
995066687 5:107870538-107870560 TGGAAAACCCATGATATGGAAGG + Intronic
995475101 5:112539614-112539636 AGGGAACCCCTTGAGGAGGAAGG - Intergenic
995685494 5:114767529-114767551 TGGAGTACAAATGAGGAGGAAGG + Intergenic
998214171 5:140224939-140224961 TGGGAAACCAAGCAGGAGGATGG + Intronic
998365620 5:141628908-141628930 GGGAATAGCCATGAGGAGGAGGG + Intronic
998584668 5:143414457-143414479 TGGAAAACCCATCAGGCCTATGG - Intronic
999221612 5:149984040-149984062 TGGAAAATCCCTCAGAAGGAGGG + Exonic
1000435166 5:161199139-161199161 TGGAAAACACAGGAAGGGGAGGG + Intergenic
1001055328 5:168444701-168444723 TAGAGAACCCATGAGGAGAGGGG - Intronic
1001403335 5:171459517-171459539 TGGAAGCCCCATGAGGACCAGGG - Intergenic
1001745485 5:174089378-174089400 AGGGAAACCCATGAGGTGGAAGG + Intronic
1002086940 5:176781854-176781876 TGGAGACCCCAAGAGCAGGAAGG + Intergenic
1002309249 5:178304728-178304750 TGGAAAAACAATGAGGGGGAGGG + Intronic
1003214583 6:4097746-4097768 TGGAACACCCAAAAGAAGGAAGG + Intronic
1006615948 6:35326988-35327010 TGGAGAACCCACGAGTAGAAAGG + Intergenic
1009301383 6:62027528-62027550 TGGAAAGCCCCTAAGGATGAGGG + Intronic
1010612802 6:77975622-77975644 TAGAAAACCAATAAGGAAGATGG + Intergenic
1012394300 6:98778292-98778314 TGGAAGAGTCCTGAGGAGGATGG + Intergenic
1012773511 6:103473579-103473601 TGGAAAACCTGTGAGAATGAAGG + Intergenic
1017515971 6:155156108-155156130 TGGAAGACCCTGGAGGAGGGAGG + Intronic
1017888629 6:158621454-158621476 CTGAAAACCCAGGAAGAGGATGG - Intronic
1019108361 6:169689208-169689230 TGGAAAGCCCGTGAGAAGAATGG - Intronic
1019324718 7:432476-432498 TGGGAAACGCAGGAGGAAGATGG - Intergenic
1019369750 7:655470-655492 TGGAAAAGCCATGCTGAGAAGGG - Intronic
1019774594 7:2905145-2905167 TGGAAACCCCACTTGGAGGATGG - Intergenic
1019903654 7:4043975-4043997 AAGAAAACACAAGAGGAGGAAGG - Intronic
1020116703 7:5480203-5480225 ACGGAAACCCAGGAGGAGGAAGG + Intronic
1022604207 7:31792373-31792395 TTGAATAAGCATGAGGAGGATGG + Intronic
1023714635 7:43030546-43030568 TAGAATACCCATGAAGAGTAAGG + Intergenic
1026033054 7:66811928-66811950 TAGAAAACCCAAGAGAAGGCTGG + Intergenic
1028090222 7:86691258-86691280 CGGAAGACAAATGAGGAGGATGG - Intronic
1028093895 7:86736613-86736635 TGGAAACCACATGTGGAAGATGG - Intronic
1034427425 7:151021404-151021426 AGGAAAAACCATCATGAGGAGGG + Intronic
1034534745 7:151719790-151719812 TGGCAAACTCAGGGGGAGGAGGG - Intronic
1035627913 8:1087820-1087842 TGGCAAGCCCATGAAGAGAAAGG - Intergenic
1036100913 8:5783686-5783708 TGGAAGACACAAGAGGAGCAAGG - Intergenic
1036293750 8:7518212-7518234 GGGCAAAGCCAGGAGGAGGAAGG + Intergenic
1036328811 8:7802783-7802805 GGGCAAAGCCAGGAGGAGGAAGG - Intergenic
1037280571 8:17237296-17237318 TTTAAAAAACATGAGGAGGAAGG - Exonic
1039666654 8:39540677-39540699 TGGGAAATGCTTGAGGAGGAAGG - Intergenic
1039818504 8:41115741-41115763 TGCAAAAGCCATGCGGTGGAGGG - Intergenic
1040558918 8:48506423-48506445 TGGAAAAGCCTTGAGGAAGAGGG + Intergenic
1041225448 8:55692790-55692812 TGTAGATCCCAAGAGGAGGAAGG - Intergenic
1041469646 8:58194306-58194328 TGGAAATTCCCTGAGGATGAGGG + Intronic
1041518954 8:58733560-58733582 TGGAATCCCCATGAGGAGATTGG + Intergenic
1041861701 8:62521242-62521264 AGGAAAACCCATGGGTAGAAAGG + Intronic
1047866649 8:129031639-129031661 TGGAACACCCAGAAGGAGAATGG - Intergenic
1049103850 8:140598888-140598910 AGGAAAACGCATGGGGAGGCTGG - Intronic
1050334616 9:4578513-4578535 GGGAAAACCCAAGAGGGAGAGGG + Intronic
1050775093 9:9249615-9249637 TGGACAACCCAAGAGAAAGAAGG - Intronic
1051608809 9:18942097-18942119 AGAAAAACCAATGAGGTGGAGGG - Intronic
1051713790 9:19960424-19960446 TTGGAAACCAATGAGGTGGAAGG + Intergenic
1055064716 9:72107282-72107304 AGGAGAACCCAGGAGGTGGAGGG + Intergenic
1055660601 9:78500116-78500138 TGGAATGACCATGTGGAGGAGGG + Intergenic
1057798010 9:98172049-98172071 GCGGAACCCCATGAGGAGGAGGG + Intronic
1059039910 9:110801142-110801164 TGCAAAACCCATGTGGTAGACGG + Intronic
1062131279 9:134894797-134894819 TGGCAAACCCTTGGGGAAGATGG + Intergenic
1062609519 9:137367755-137367777 GGGTCAGCCCATGAGGAGGATGG + Intronic
1186406098 X:9304479-9304501 TGGTGAACCCAGGAGGTGGAGGG + Intergenic
1186744914 X:12557560-12557582 TGGGAAACCCAAGAGGGAGAAGG - Intronic
1187757293 X:22541942-22541964 AGAGAAACCCATGAAGAGGAAGG - Intergenic
1189556892 X:42154222-42154244 TGGAGAACTCCTCAGGAGGAAGG + Intergenic
1189938577 X:46096771-46096793 TTGGACACCCATGAGGAGAAGGG - Intergenic
1190790211 X:53692683-53692705 TGGACAACATATGAGGATGAGGG - Intergenic
1191806120 X:65135293-65135315 TGGAAAACTCAAGAGGAGAAGGG + Intergenic
1195366894 X:104135151-104135173 TGAGAAACCCATGAGAAAGATGG - Intronic
1195633774 X:107089834-107089856 TAAAAAACCCATTAGGTGGAAGG - Intronic
1195929658 X:110061888-110061910 TGGAAAAACCATCTGGAAGAGGG + Intronic
1198276639 X:135100282-135100304 TTAAAAACTCATGAGGAGGATGG - Intergenic
1198276812 X:135102357-135102379 TTAAAAACTCATGAGGAGGATGG + Intergenic
1198452701 X:136783666-136783688 TGGAAAGCCCTTGAAGAGGCAGG - Intergenic
1198463591 X:136885163-136885185 TAGAAGATCCATGAGGAGGAGGG - Intergenic
1198744966 X:139880536-139880558 TGGAAAACAAAGGAGGAAGATGG + Intronic
1200873396 Y:8126697-8126719 TGAGACACCCATGAGGAGCAAGG - Intergenic