ID: 1074722228

View in Genome Browser
Species Human (GRCh38)
Location 10:116272975-116272997
Sequence CCCGCAGTCCCGGCGTGCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 131}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074722219_1074722228 2 Left 1074722219 10:116272950-116272972 CCCCAGCCCAGGGCGAGCGCGCC 0: 1
1: 0
2: 2
3: 18
4: 192
Right 1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 131
1074722214_1074722228 25 Left 1074722214 10:116272927-116272949 CCCAGGACTCGGGCGCTTCCGCA 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 131
1074722223_1074722228 -4 Left 1074722223 10:116272956-116272978 CCCAGGGCGAGCGCGCCGGCCCG 0: 1
1: 0
2: 0
3: 12
4: 107
Right 1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 131
1074722224_1074722228 -5 Left 1074722224 10:116272957-116272979 CCAGGGCGAGCGCGCCGGCCCGC 0: 1
1: 0
2: 0
3: 18
4: 217
Right 1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 131
1074722221_1074722228 0 Left 1074722221 10:116272952-116272974 CCAGCCCAGGGCGAGCGCGCCGG 0: 1
1: 0
2: 1
3: 24
4: 181
Right 1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 131
1074722218_1074722228 7 Left 1074722218 10:116272945-116272967 CCGCACCCCAGCCCAGGGCGAGC 0: 1
1: 0
2: 4
3: 63
4: 594
Right 1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 131
1074722215_1074722228 24 Left 1074722215 10:116272928-116272950 CCAGGACTCGGGCGCTTCCGCAC 0: 1
1: 0
2: 0
3: 3
4: 51
Right 1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 131
1074722220_1074722228 1 Left 1074722220 10:116272951-116272973 CCCAGCCCAGGGCGAGCGCGCCG 0: 1
1: 0
2: 1
3: 17
4: 139
Right 1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG 0: 1
1: 0
2: 0
3: 16
4: 131

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074722228 Original CRISPR CCCGCAGTCCCGGCGTGCCC CGG Intronic
900099119 1:953584-953606 CAGGCAGTCCCTGCCTGCCCGGG - Intronic
900407923 1:2500589-2500611 CCCGCCGCCCCTGCATGCCCAGG + Intronic
900985914 1:6072758-6072780 CCCGCAGGCCAGACTTGCCCAGG - Exonic
901381632 1:8878466-8878488 CCCGCAGGCCCAGCGTGGCGGGG - Intronic
901672702 1:10865694-10865716 ACCGCGGTCCCGGAGGGCCCTGG - Intergenic
902410016 1:16206965-16206987 CCCGCAGGCTCAGCGTGGCCAGG + Exonic
902872705 1:19324172-19324194 CCTGGAGACCCGGCGTGCCCAGG + Intronic
902874277 1:19331622-19331644 CCCGAAGCCCCAGCTTGCCCTGG + Intergenic
903269355 1:22178019-22178041 CCCGCACCCCCTGCCTGCCCAGG + Intergenic
903486339 1:23691875-23691897 CCCGCAGGCTCGGCCTGCCATGG - Intronic
906323190 1:44829139-44829161 CCTGCAGTCCTGGCGTACCTGGG + Exonic
1064088114 10:12360876-12360898 TCTGCAGTCCCGGCCTGGCCCGG - Intronic
1064380706 10:14838805-14838827 CTCGCAGCCCCGCCGTCCCCGGG - Intronic
1067779349 10:49188276-49188298 CCCGCAGTCCCCACTTACCCAGG + Exonic
1070727576 10:78802803-78802825 CCAGCAGTCCCTGCCTGGCCTGG - Intergenic
1071530891 10:86389769-86389791 CCAGCGGACCCGGCGTGGCCCGG - Intergenic
1072278485 10:93845289-93845311 CCGGCAGGCCCTGCCTGCCCCGG + Intergenic
1074722228 10:116272975-116272997 CCCGCAGTCCCGGCGTGCCCCGG + Intronic
1074814471 10:117134234-117134256 CCCCCCGGCCCGGCGGGCCCGGG + Exonic
1076882856 10:133248040-133248062 CCCGCCCGCCCGGCGGGCCCTGG - Intergenic
1077229038 11:1450502-1450524 CCCGCAGGGCAGGCGGGCCCAGG - Intronic
1077453084 11:2662596-2662618 CCCGCCGTCACGGCATGGCCAGG + Intronic
1078800879 11:14643582-14643604 CACGCCGACCCAGCGTGCCCAGG - Exonic
1079627755 11:22635583-22635605 CCTGCAGACCTGGAGTGCCCAGG + Intronic
1080451520 11:32382194-32382216 CCCGCATTCCAGCCCTGCCCTGG - Intergenic
1080677116 11:34438684-34438706 CCCGCCGGCCCGGGGTGCCCGGG - Intergenic
1089260127 11:117218481-117218503 TCCGCAGTCCCCCCGTTCCCTGG - Exonic
1091414861 12:273151-273173 CCCGCAATCCCTGCCTCCCCTGG + Intergenic
1100844652 12:98645545-98645567 CCCACAGTCCCGGAGCGCCGCGG - Exonic
1104688538 12:130806675-130806697 TCCTCAGTCCCGCCCTGCCCTGG - Intronic
1108404068 13:50082045-50082067 CCCGCGTTCCCGGCATTCCCTGG - Intergenic
1110860848 13:80342900-80342922 CCCGCAGTCCCGGGACGCTCGGG - Intergenic
1113120190 13:106917420-106917442 CCCGCAATCCAAGCGTTCCCAGG - Intergenic
1113476939 13:110590666-110590688 CCAGCTGTCCTGGCTTGCCCAGG - Intergenic
1113913548 13:113856307-113856329 CCCCCAGTCCCAGCGAGCACAGG + Intronic
1115651169 14:35403984-35404006 CCCGCGGCCCCGGCGGGCGCCGG + Intronic
1121546717 14:94768696-94768718 CCCCCAGTCCCGGGGCACCCGGG + Intronic
1123061858 14:105598098-105598120 CGCGCAGTCCCAGAGGGCCCCGG - Intergenic
1123086598 14:105719829-105719851 CGCGCAGTCCCAGAGGGCCCCGG - Intergenic
1123630764 15:22258259-22258281 CCCCCGGTCCCGGCGCGCCCCGG + Intergenic
1124966670 15:34437245-34437267 CCCGCAGCCCCGCCGAGTCCGGG + Intronic
1124983289 15:34583363-34583385 CCCGCAGCCCCGCCGAGTCCGGG + Intronic
1127267928 15:57376385-57376407 CCGGCAGCCCCGGCGGGTCCAGG + Intronic
1127976256 15:63999309-63999331 CTCCCAGTCCCCACGTGCCCTGG - Intronic
1128757276 15:70191565-70191587 CCAGCAGTCCCAGCATGGCCAGG + Intergenic
1129862384 15:78872771-78872793 CTACCAGTCCCGGCGTGCCCTGG + Intronic
1136096820 16:27962876-27962898 CCCACAGTCCCAGCATGCACTGG + Intronic
1137476103 16:48811181-48811203 GCCGCCGTCCCCGCGTGCCCCGG - Intergenic
1137587654 16:49673448-49673470 CCCGCAGTCCAGGCCAGCCTCGG - Intronic
1138512224 16:57515330-57515352 CCTGCAGTCCAGGTGGGCCCCGG - Exonic
1141427535 16:83953619-83953641 GCCACAGTCCCAGCGTACCCTGG + Intronic
1141972280 16:87492314-87492336 TCCCCGGTCCCGGCGCGCCCCGG - Intergenic
1142163386 16:88570776-88570798 CCCGCGGTCCTGGGGCGCCCTGG + Intronic
1142206463 16:88785295-88785317 CCCGACGGCCCGGCGCGCCCAGG + Intergenic
1142251930 16:88995990-88996012 ACCGCAGACCCGGGGAGCCCAGG - Intergenic
1142810554 17:2393788-2393810 CCTGCAGCCTCGGCGTCCCCGGG - Intronic
1143520168 17:7440225-7440247 CCCCCAGCCCCCGCCTGCCCCGG + Intronic
1148323636 17:46771483-46771505 CCCGCCGCCCCCGCGTTCCCGGG - Intronic
1151143888 17:72020794-72020816 CCAGCAGTCCCAGCTTGCCCAGG - Intergenic
1152103161 17:78314433-78314455 CCCGCAGCCACGCCCTGCCCAGG + Intergenic
1152231934 17:79118096-79118118 CCCCCAGTGCCGGCCGGCCCTGG + Intronic
1152422747 17:80202903-80202925 CCAGCTGTCCCTGCTTGCCCAGG - Intronic
1152628288 17:81398464-81398486 GCCGCAGACCCCGCGTACCCAGG + Intronic
1152781429 17:82228863-82228885 CCCGCAACCCCGCCGGGCCCAGG - Intronic
1152933303 17:83121460-83121482 CCCGCTGTCCCGGAGAGCCCAGG + Intergenic
1160560717 18:79754265-79754287 CCGACAGTCACGGCGTTCCCCGG - Exonic
1160579348 18:79874845-79874867 CCTGAAGTCCCGGCCTGCGCTGG - Intronic
1160883112 19:1331540-1331562 TCCGGAGGCCCAGCGTGCCCCGG - Intergenic
1160966679 19:1749787-1749809 CCCGCAGTTGCGGGGCGCCCGGG - Intergenic
1161351226 19:3793008-3793030 CCCTCAATCCCGGAGTCCCCTGG - Intronic
1161483990 19:4525027-4525049 CCCACCGCCCCGGCCTGCCCTGG - Exonic
1161925272 19:7294551-7294573 CCCTCGGTCCCGGCGCGCCCAGG - Intergenic
1162100456 19:8335596-8335618 CGCGCCGTCCCCGCGCGCCCCGG - Exonic
1162346273 19:10119752-10119774 CCCGCAGCCTCGGCGTACCCAGG + Intronic
1162410652 19:10503141-10503163 CCCGGAGCCCCTGCGCGCCCCGG - Intronic
1162550264 19:11354813-11354835 CCTGCAGCCCCGGAGTCCCCTGG + Intronic
1163723114 19:18907557-18907579 CCCTCAGTCCCTGAGAGCCCAGG + Intronic
1163783270 19:19261525-19261547 CCCTCGGTCCCGGCGCGCTCTGG - Exonic
1165113501 19:33515249-33515271 CCTGGAGTCCCAGCCTGCCCAGG + Intronic
1168334955 19:55592373-55592395 CGCGCAGTCCCGAGGTCCCCTGG + Exonic
925169429 2:1741966-1741988 CCCTCAGTCCCTGCCTCCCCAGG + Intronic
926168920 2:10538563-10538585 GCTGCTGTCCCGGTGTGCCCAGG + Intergenic
930198474 2:48530738-48530760 CCCGGAGTCCCCTCCTGCCCTGG + Exonic
946176189 2:217923082-217923104 CCCACAGTCCTGGAGTCCCCAGG + Intronic
946685433 2:222265027-222265049 CCCGCATTCCCACAGTGCCCTGG + Intronic
948605875 2:239134425-239134447 CCTGCTGGCCCGCCGTGCCCTGG + Exonic
1171430731 20:25081903-25081925 CCGGCAGTCGCGCCGTGCCCGGG - Exonic
1175215800 20:57391296-57391318 CCGGCGGTCCCCGCGCGCCCGGG + Intergenic
1175367757 20:58467370-58467392 CGCGCAGTCCCGGCCGGCGCGGG + Exonic
1176550805 21:8220269-8220291 GCCGCTGTCTCGCCGTGCCCCGG + Intergenic
1176569603 21:8402536-8402558 GCCGCTGTCTCGCCGTGCCCCGG + Intergenic
1178030183 21:28517065-28517087 GCCTGAGTCCCTGCGTGCCCTGG - Intergenic
1178485911 21:33020175-33020197 CCCGCAGTCCCGCCATGGCCTGG + Intergenic
1178708039 21:34890148-34890170 CGCGCAGTCCGGGCCCGCCCGGG - Intronic
1179511950 21:41879183-41879205 CCCGCTGCCCCCGCGAGCCCCGG - Intronic
1179605606 21:42513717-42513739 GCCCCGGCCCCGGCGTGCCCAGG - Intronic
1181015622 22:20066830-20066852 CCCAGAGACCCGGCCTGCCCAGG + Intergenic
1181469960 22:23132183-23132205 CCCTCACTCCCCGTGTGCCCTGG - Intronic
1184236988 22:43187681-43187703 CCCGCCCTCCCGGCATTCCCCGG - Intergenic
1184640215 22:45866637-45866659 CCCGCAGTCCCACAGTGCCCGGG + Intergenic
1184644496 22:45888824-45888846 CCCGCAGTCCCTCCTTGCCCGGG + Intergenic
1184680845 22:46071481-46071503 CCCGCAGAACAGGGGTGCCCGGG + Intronic
1203255708 22_KI270733v1_random:136593-136615 GCCGCTGTCTCGCCGTGCCCCGG + Intergenic
954459314 3:50617404-50617426 CCCGCACTCCCAGCTTGCCCCGG + Intronic
959622612 3:108414413-108414435 CCTACAGTCCCAGAGTGCCCTGG - Exonic
965757307 3:172039953-172039975 CCCGTGTTCCCGGGGTGCCCAGG - Intronic
968428086 4:536146-536168 CCCGCAGACTCGGCGGGCCCGGG + Intronic
968451397 4:677663-677685 CCTGCAGTTCCAGGGTGCCCAGG + Intronic
968501050 4:950243-950265 CCAGCAGACCCTGAGTGCCCTGG - Intronic
974108937 4:57503775-57503797 CCCTCAGTCCCTGAGTTCCCAGG + Intergenic
978607587 4:110498632-110498654 GCCGCAGCCCCGCTGTGCCCTGG - Intronic
984734570 4:183098327-183098349 ACCGCAGCCCCGCCGTGGCCAGG - Intergenic
985723435 5:1502555-1502577 CCCGCAGCCTCGGCCTTCCCTGG - Intronic
990210789 5:53480239-53480261 CCGGCAGCGCCGGCGCGCCCGGG - Intergenic
999306204 5:150521210-150521232 ACCGGAGGCCCGGCCTGCCCTGG - Exonic
1002190196 5:177473767-177473789 CCCCCCTTCCCGGCCTGCCCCGG + Intronic
1002923987 6:1594524-1594546 CCCGCAGTCGCTCCCTGCCCAGG - Intergenic
1003175666 6:3751115-3751137 CCCGCAGACGAGGGGTGCCCGGG - Intronic
1003921700 6:10838629-10838651 CCCGCAGGCCCCGCCTTCCCCGG + Intronic
1006116075 6:31776840-31776862 CCCGCAGAGCCGGCCTGCCCTGG - Intronic
1006180362 6:32150459-32150481 CCCACAGTCCCCGCGTGCGTGGG + Exonic
1006694648 6:35920851-35920873 CCCTCAGTCCGGGCGTCCTCTGG - Intronic
1007927657 6:45663282-45663304 CCCGCAGCCTCGGCGCCCCCAGG + Intronic
1009975621 6:70667925-70667947 CCCGCGGTCCCGGCGGCGCCAGG + Exonic
1011882370 6:92045746-92045768 CCCCCAGTCCAGCCATGCCCAGG - Intergenic
1020110207 7:5443544-5443566 CCGACCGACCCGGCGTGCCCGGG + Intronic
1022109697 7:27220710-27220732 CCCGCCTGCCCGGCTTGCCCGGG + Intergenic
1023629428 7:42148872-42148894 CCCGGAGGCCCCGCGTCCCCAGG - Intronic
1029423450 7:100483507-100483529 CCCGTACGCCCGGCGCGCCCCGG - Intergenic
1032119396 7:129145229-129145251 CCTGCAGACGCGGCGTCCCCGGG - Intronic
1033361274 7:140640553-140640575 CCAGCCGTCCCGGCCCGCCCCGG - Exonic
1034174568 7:149090645-149090667 CCCGCGGTCCCGCCCGGCCCTGG + Exonic
1034494658 7:151412224-151412246 CCTGGAGTCCCGTGGTGCCCAGG + Intergenic
1035277762 7:157758262-157758284 CCCACAGTCCAGGCCTGTCCAGG + Intronic
1035297536 7:157875830-157875852 CCCCCAGGCCAGGCGTCCCCAGG + Intronic
1049726462 8:144148553-144148575 CCTGCAAAGCCGGCGTGCCCCGG + Intronic
1049780951 8:144428645-144428667 CCCGAAGTCCGGGCGGGCGCGGG - Intergenic
1050284782 9:4090047-4090069 CCTGCAGTCCCTGTGAGCCCAGG - Intronic
1052862906 9:33447668-33447690 CCTGCAGTCCCGGAGCGCCGAGG + Intergenic
1057220633 9:93256081-93256103 CCCCCAGCCCAGGGGTGCCCGGG - Intronic
1061007128 9:127934713-127934735 CCAGCAGTCCCACCGTGCCTGGG - Intergenic
1061509787 9:131053320-131053342 CCGGCAGTCCAGGAGTCCCCTGG + Intronic
1062014050 9:134282440-134282462 CCCTCAGTGTCGGCGTGACCAGG - Intergenic
1062556210 9:137114412-137114434 CCCGCCGTCCCGCCGCCCCCCGG - Intronic
1189296642 X:39923178-39923200 CTCGCAGTCCCGTCCTGCACAGG + Intergenic
1192166226 X:68829249-68829271 CCCGGAGTCCCAGTGTGGCCCGG + Exonic
1192166701 X:68831183-68831205 CCCCCAGCCCCGCCCTGCCCCGG + Intronic
1200044855 X:153396046-153396068 CACGCAGCCCCGCTGTGCCCCGG + Intergenic