ID: 1074725778

View in Genome Browser
Species Human (GRCh38)
Location 10:116307511-116307533
Sequence GAAGCATCCTTAACCATGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074725778_1074725780 -10 Left 1074725778 10:116307511-116307533 CCAAACATGGTTAAGGATGCTTC No data
Right 1074725780 10:116307524-116307546 AGGATGCTTCATGAAATAAAGGG No data
1074725778_1074725781 -2 Left 1074725778 10:116307511-116307533 CCAAACATGGTTAAGGATGCTTC No data
Right 1074725781 10:116307532-116307554 TCATGAAATAAAGGGCTTTGTGG No data
1074725778_1074725785 30 Left 1074725778 10:116307511-116307533 CCAAACATGGTTAAGGATGCTTC No data
Right 1074725785 10:116307564-116307586 TTTGGGAAGATCGTATTAAATGG No data
1074725778_1074725782 12 Left 1074725778 10:116307511-116307533 CCAAACATGGTTAAGGATGCTTC No data
Right 1074725782 10:116307546-116307568 GCTTTGTGGCCAAATAAATTTGG No data
1074725778_1074725783 13 Left 1074725778 10:116307511-116307533 CCAAACATGGTTAAGGATGCTTC No data
Right 1074725783 10:116307547-116307569 CTTTGTGGCCAAATAAATTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074725778 Original CRISPR GAAGCATCCTTAACCATGTT TGG (reversed) Intergenic
No off target data available for this crispr