ID: 1074727864

View in Genome Browser
Species Human (GRCh38)
Location 10:116332312-116332334
Sequence CAGTAAAAGCAAAAGTAGAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 842
Summary {0: 1, 1: 1, 2: 6, 3: 91, 4: 743}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074727864 Original CRISPR CAGTAAAAGCAAAAGTAGAA AGG (reversed) Intronic
903424408 1:23243154-23243176 CATTAAAAAAAAAAGAAGAATGG + Intergenic
904448428 1:30594860-30594882 TAGAAACAGAAAAAGTAGAATGG + Intergenic
906626776 1:47332129-47332151 CACCAAAAGAAAAAGGAGAATGG + Intergenic
907378796 1:54067551-54067573 CAGGAAAAGGAAAAGAGGAAAGG - Intronic
907400067 1:54219600-54219622 CTGTAAAATAAAAAGTAAAATGG - Intronic
907683296 1:56584987-56585009 CATTAAAAAAAAAATTAGAACGG + Intronic
908677955 1:66627320-66627342 CAACAAAAGCAAAAGTGGAAAGG + Intronic
908968942 1:69801816-69801838 CATTAAAAAAAAAAATAGAAAGG - Intronic
909222091 1:72978344-72978366 CAGTGTAAGCAAGAGTAGAAGGG + Intergenic
909247304 1:73302572-73302594 CAGCAAAAGCCAAGATAGAACGG + Intergenic
909783450 1:79579398-79579420 CAGTAAAAAAAAATGTAAAAAGG + Intergenic
910042956 1:82875274-82875296 GAGTAAAAGCAAAGGCAGAAGGG + Intergenic
910806184 1:91191632-91191654 AAGGAACAGCAAAAGGAGAAAGG - Intergenic
911418875 1:97613785-97613807 TAGTAAAGGCACAAGTAGAAAGG + Intronic
911891098 1:103373023-103373045 CAGTCAAAGCAACAGTAGACTGG + Intergenic
911911785 1:103646767-103646789 CAATTAAAGCAAAACTAGATGGG + Intergenic
911916669 1:103705181-103705203 CAATTAAAGCAAAACTAGATGGG - Intronic
911919200 1:103740905-103740927 CAATTAAAGCAAAACTAGATGGG + Intronic
912053769 1:105568609-105568631 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
912662727 1:111547976-111547998 CAGTCAAAGCAAAAGTGAACTGG - Intronic
913326503 1:117632856-117632878 CAGTAATATCTAAAGTAGGATGG - Intergenic
913676339 1:121144417-121144439 GAGTCAAAGCAAAAGTGGATTGG + Intergenic
913944288 1:125143110-125143132 AAGGAAGAGGAAAAGTAGAAAGG + Intergenic
914028234 1:143932367-143932389 GAGTCAAAGCAAAAGTGGATTGG + Intergenic
915791515 1:158676972-158676994 GAATGAAAGAAAAAGTAGAATGG + Intronic
916307761 1:163358462-163358484 CAGTAAAAATAAAAGAAAAAAGG - Intergenic
916508988 1:165454617-165454639 CACCAAAAGCAAAAGCAAAAAGG + Intergenic
916551577 1:165854845-165854867 CAGGAAAAACAGAAGTATAAAGG - Intronic
916824138 1:168428214-168428236 CAGAAAAAGGAAAAGTGGAGAGG + Intergenic
917606151 1:176631951-176631973 GAGTGTAAGCAAAAGGAGAAAGG + Intronic
917908662 1:179616639-179616661 TAGTGAAAGAAAAACTAGAAAGG - Intronic
918350682 1:183652725-183652747 CAGACAAAGCAAAAGGAAAAGGG - Intronic
919008855 1:191933517-191933539 CAGTAAAAGCAATACTAAGAGGG + Intergenic
919105701 1:193147901-193147923 CTGTAAAAGCCAGAGAAGAAGGG + Exonic
919225572 1:194695555-194695577 AAGTAAAACAAAAAATAGAAAGG + Intergenic
919525637 1:198646202-198646224 CAGTAAAATTAAAATTAAAATGG - Intronic
919716116 1:200778565-200778587 CACAAAAAGCAAAGGTAGAGAGG - Intronic
919876918 1:201876064-201876086 CAGAAGGAGCAAATGTAGAAAGG - Exonic
920584997 1:207150224-207150246 CAGCAACAGAAAAAGAAGAAAGG - Intergenic
920612989 1:207459985-207460007 CAGAAATAGCAAAAGCAGAAGGG - Intronic
920618978 1:207525301-207525323 CAGGAAAAGCAATAGGACAAAGG + Intronic
920620759 1:207543857-207543879 CAGGAAAAGCAATAGGACAAAGG + Intronic
920622541 1:207562414-207562436 CAGGAAAAGCAATAGGACAAAGG + Intronic
920707215 1:208261802-208261824 CAGTCAAAGCAAAGGTGGACTGG - Intergenic
921393798 1:214646673-214646695 CCCTAAAAGCAAAAATAGAAGGG + Exonic
921452666 1:215327151-215327173 CTGTAAAAGAAATACTAGAAAGG + Intergenic
921457029 1:215383748-215383770 CAGCAAAAGCAATACTAAAAGGG + Intergenic
921717273 1:218430524-218430546 CAGCAAAGGCTAAAATAGAATGG + Intronic
921879729 1:220242091-220242113 CAGTAATAGCAAAATTAGGCTGG - Intronic
921941945 1:220850687-220850709 CAGCAAAAGCAATAGTAAGAAGG - Intergenic
921997883 1:221441351-221441373 CAGTAAAAGGAAAAGCTCAAAGG + Intergenic
922135733 1:222824421-222824443 GTGTATAAGCAAAAGCAGAAGGG - Intergenic
922300695 1:224297430-224297452 CATTAAGACAAAAAGTAGAATGG + Intronic
922556612 1:226537354-226537376 CTGTAATAGCAAAAGTGGAGGGG + Intergenic
922903521 1:229156647-229156669 CAATAAAACCAACAGTAGGAAGG - Intergenic
923033669 1:230268986-230269008 AAGGAAAAGCAAAAGCAGAGTGG - Intronic
923926629 1:238635972-238635994 TAGTCAAAGCAAAAGCAGACTGG + Intergenic
1063556664 10:7086772-7086794 AAGTAAAGGCAAAAAGAGAAAGG - Intergenic
1063819138 10:9814109-9814131 CAGTAAAACCACAAGGAGAAAGG - Intergenic
1064292315 10:14047208-14047230 CAATAAAAGCAAAATTCCAAAGG - Intronic
1064688354 10:17887504-17887526 CTGAAGAAGCGAAAGTAGAATGG + Intronic
1065447665 10:25819993-25820015 CAGCAAAAGCAGAATTAGAGTGG - Intergenic
1065709536 10:28502178-28502200 CAGTAAATGCAAAATTACAGTGG + Intergenic
1066075188 10:31868235-31868257 CAGGAAAAAAAAAAGTATAAGGG + Intronic
1066363018 10:34749115-34749137 AAATAAAAGCAAAAGTATATGGG - Intronic
1067932840 10:50580715-50580737 CATGAAAACAAAAAGTAGAATGG + Intronic
1067989923 10:51200376-51200398 CAATAAATACAAAAGTAGACAGG + Intronic
1068124823 10:52826730-52826752 AAGTAAGAGGAAAAGGAGAAGGG - Intergenic
1068343261 10:55736995-55737017 CAGAGAAAGCAAGAGCAGAAGGG + Intergenic
1068914414 10:62413112-62413134 TAGTAAAAGTAAAAATACAAAGG + Intronic
1069088346 10:64168962-64168984 CAGTAAATGTAGAAGTTGAAGGG + Intergenic
1069210626 10:65755077-65755099 CAGTAAATGGAAAAATAAAATGG - Intergenic
1070028128 10:72651307-72651329 CAAAAAAAGAAAAAGAAGAAGGG + Intergenic
1070080492 10:73181399-73181421 CAGCAAAAGCAATACTAGGAGGG - Intronic
1070478986 10:76862567-76862589 CAGACAAAGCAAAAGTGGACTGG + Intergenic
1070732049 10:78836527-78836549 CAGTAAAAACAAAAGCCAAAAGG + Intergenic
1071123688 10:82310001-82310023 AAGTTACAGCAAAAGTAGGAAGG - Intronic
1071167447 10:82823028-82823050 CAGAAGAAGGAAAAGTAAAAGGG - Intronic
1071206063 10:83279839-83279861 CAGAGAAAGAAAAATTAGAAAGG + Intergenic
1071347118 10:84703343-84703365 CAGCAGAAGCAAAAGTAGCCTGG - Intergenic
1071409256 10:85372447-85372469 CAAAAAAGGCAAAAGCAGAAAGG - Intergenic
1072171974 10:92872038-92872060 CATTAAAAATAAAAGCAGAAAGG - Intronic
1072226712 10:93376855-93376877 CAGTAAAAGAGCAAGTAAAAGGG + Intronic
1072344125 10:94486450-94486472 CAGCAAAAGCAACACTAAAAGGG - Intronic
1072437036 10:95423398-95423420 AAGAAAAATCAAAAGAAGAATGG - Intronic
1073230919 10:101969117-101969139 CAGTAAAAACTAGAGTAGATGGG - Intronic
1073676746 10:105655782-105655804 CTGCAACAGCAAAAGCAGAATGG + Intergenic
1073718750 10:106140541-106140563 TATTAAAAACAAAAGTAGTAGGG - Intergenic
1073869234 10:107843419-107843441 CAATAAAAGTTAAAGTAGGATGG - Intergenic
1073993487 10:109290390-109290412 CACTAAAAGCAAAACAAAAAGGG + Intergenic
1074296374 10:112193148-112193170 CAGAGAAGACAAAAGTAGAAGGG + Intronic
1074563788 10:114558179-114558201 CAGTACTAGCTAAAGGAGAAGGG - Intronic
1074575281 10:114663119-114663141 CAGGAAAAGCAAAAGAAGCAGGG - Intronic
1074620359 10:115113099-115113121 CAATCAAAGCAAAAGTGGACTGG + Intronic
1074727864 10:116332312-116332334 CAGTAAAAGCAAAAGTAGAAAGG - Intronic
1074962418 10:118459262-118459284 CAATATAAGCAAAAGTGGACAGG + Intergenic
1075403233 10:122176179-122176201 TAGAAAAGGCCAAAGTAGAATGG + Intronic
1076204358 10:128584157-128584179 CAACAAAAGCAAAACTATAAAGG - Intergenic
1076286400 10:129301711-129301733 TAGAAAAAGCAAAACTATAAGGG + Intergenic
1077676633 11:4200123-4200145 CAATAAAAACAAAAATAGATGGG - Intergenic
1077725768 11:4673377-4673399 CAGTAAAAAGAAAGGTAGCATGG - Intergenic
1077810961 11:5636529-5636551 CAGTAAAAACAAAAACAAAAAGG + Intronic
1079141439 11:17812727-17812749 CAGTATAATGAAAAGTAGACTGG - Intronic
1079287151 11:19145776-19145798 GACTAAAAGCAAACTTAGAATGG - Intronic
1079294223 11:19217876-19217898 TATTAAAACCAAAAGGAGAACGG + Intergenic
1079561233 11:21822236-21822258 CAATAAAAGCAAAAGGAGGTGGG + Intergenic
1079583763 11:22098971-22098993 CTGTAAAAGCTAAAGCAGCATGG + Intergenic
1079634612 11:22720556-22720578 CAGTGAAACTAAAAGTAGCAAGG + Intronic
1079692004 11:23430511-23430533 CAGTAAAAGCAATAGTAAGATGG - Intergenic
1080068997 11:28056429-28056451 CATTAAAAGCAAAAGAGTAAAGG + Intronic
1080553932 11:33398730-33398752 CACAAAAAGCAAAAGATGAAAGG - Intergenic
1081009195 11:37786672-37786694 CAGTCAAAGCAAAAGTGAATAGG + Intergenic
1081051603 11:38349101-38349123 CAATTATAGCAAAAGGAGAAGGG + Intergenic
1081123733 11:39297147-39297169 CAGTGAAAACAATAGTAAAAGGG + Intergenic
1081143225 11:39530248-39530270 CAACAAAAGCAAAATTAGGAGGG - Intergenic
1081301645 11:41459637-41459659 CATCAAAGGCAAAAGCAGAAGGG + Intronic
1081996959 11:47371911-47371933 CAGAAAATGCAAAAGCAGAAAGG - Intronic
1082043389 11:47705656-47705678 AAGAAAAAGAAAAAGAAGAAAGG + Intronic
1082204012 11:49408959-49408981 AAGTATAAGAAAAAGTACAATGG + Intergenic
1082679213 11:56148078-56148100 CAGACAAAGCAAAAGCAGACAGG - Intergenic
1082887465 11:58102338-58102360 CAGAAAGAGCAGAAGGAGAAAGG - Intronic
1082896400 11:58195059-58195081 TCATAAAAGCAAAAATAGAATGG - Intergenic
1082919378 11:58476003-58476025 CATGAAAACAAAAAGTAGAATGG - Intergenic
1082948359 11:58785163-58785185 CAGTCAAAGCAAAAGTAGATTGG - Intergenic
1082985733 11:59169512-59169534 CAGTCAAAGCAAAAGTGCACTGG - Intergenic
1084514668 11:69630125-69630147 CAGGAAGAGGAAAAGGAGAAGGG + Intergenic
1085178836 11:74515058-74515080 CAGTAAAAGCAACACTAAGAGGG + Intronic
1085376489 11:76067211-76067233 AAGTAACAGTAAAAGTAGTATGG - Intronic
1085699667 11:78734916-78734938 CAGTAACAGCCAAAGTAAGAAGG - Intronic
1085716588 11:78878911-78878933 CAGTAATAGCACAAATATAATGG + Intronic
1085857199 11:80188519-80188541 CAGTTAATGAAAAAGGAGAATGG - Intergenic
1086106599 11:83154244-83154266 CACTAAACACAAAAGTAGAAAGG - Intergenic
1086350507 11:85938924-85938946 AAGTAAAAGTAAAAAAAGAAAGG + Intergenic
1086517702 11:87632665-87632687 CAGTAAAAGTAAAACATGAAAGG + Intergenic
1086931414 11:92697282-92697304 AAGGAAAAGCAAAAGTGGTATGG - Intronic
1087159636 11:94936134-94936156 CAGAAAAAGCAGAGGTAGAGGGG + Intergenic
1087245561 11:95832079-95832101 CAGTAAAAGCAAATATTCAAAGG - Exonic
1087272555 11:96126255-96126277 CAGTAAAAACAATAGCAGAGAGG + Intronic
1087343903 11:96944640-96944662 CAGTAAGAGAAAAAGAAGACTGG + Intergenic
1087392395 11:97554141-97554163 CATTGAAAGTAAAAGTAAAATGG - Intergenic
1087685677 11:101261259-101261281 CAGTAAAAACAAAGGTTGAAAGG + Intergenic
1087866959 11:103241498-103241520 CAGTTAAATGAAAAGAAGAAAGG - Intronic
1087983641 11:104649972-104649994 AAGTAAAATAAAAAGTCGAAAGG - Intergenic
1088070178 11:105773627-105773649 CAGACAAAGCAAAAGGAAAAGGG + Intronic
1088314034 11:108488997-108489019 CTGTAAAAGCAAAACTTGGAAGG + Intronic
1088352225 11:108902762-108902784 CAATAAGAGAAAAATTAGAAAGG - Intronic
1088530260 11:110800380-110800402 AAGCAAAAGCAAAAGCAAAAAGG + Intergenic
1088650745 11:111956180-111956202 CATAAAGACCAAAAGTAGAATGG + Intronic
1088840125 11:113619832-113619854 CAGTCAAAGTAAAAGCAGACTGG + Intergenic
1089906850 11:122048872-122048894 GAGCAAAAACAAAAATAGAAGGG + Intergenic
1090378699 11:126309886-126309908 CAGAAAAGGCAGAAGAAGAAGGG - Intronic
1091502149 12:1028679-1028701 CAGTAAAATCAATAGGAAAAAGG - Intronic
1091537064 12:1421216-1421238 GAGTAAAAGCACAGGTAGATGGG - Intronic
1091682159 12:2534855-2534877 CAGTAGAAGAAAAAATGGAAAGG - Intronic
1092517351 12:9228704-9228726 TAGTAAAAGAAAAGGGAGAAAGG + Intergenic
1092655763 12:10683405-10683427 CAGCAAAAGCAAAATTAGCTGGG - Intergenic
1092887755 12:12940194-12940216 CACAGAAACCAAAAGTAGAATGG + Intergenic
1092902551 12:13073478-13073500 CAGTCCAAGAAAAAGTGGAAAGG - Intronic
1092920693 12:13229206-13229228 CAGAAAAATCAAGAGTAAAAAGG + Intergenic
1092982181 12:13807752-13807774 CAGGAAAAGTAAAGGTAGCAAGG + Intronic
1093028710 12:14268433-14268455 CAAAAAAAGCAAAAGCAGAGAGG - Intergenic
1093147135 12:15580324-15580346 CAGTGAAAGGGAAAGTAGAAAGG + Intronic
1093161052 12:15746995-15747017 CAGAAAAAGGCAAAGAAGAAAGG - Intronic
1093166162 12:15806333-15806355 CAGCAAAAGCAGCAGTAAAAGGG + Intronic
1093486498 12:19658474-19658496 AAGTAAAAGCTCAAGTAGCAAGG - Intronic
1093899035 12:24608484-24608506 TTGTGAAAGCAAAAGAAGAAGGG - Intergenic
1094018887 12:25893350-25893372 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1094129210 12:27056645-27056667 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1094761927 12:33543629-33543651 CTTTGAAACCAAAAGTAGAACGG + Intergenic
1095113077 12:38319305-38319327 CAGCATAAGCAAAGGAAGAAAGG + Intronic
1095156335 12:38860038-38860060 CAGCAAAAGCAAAATTAGGTGGG + Intronic
1095357747 12:41296327-41296349 CAGCCAAAGCAAAAGTAGACAGG + Intronic
1095703557 12:45215606-45215628 GAGAATAAGCAAAAGAAGAAGGG - Intergenic
1097498174 12:60369501-60369523 CAGTCAAAGCAAAAGTAGACTGG - Intergenic
1097924390 12:65111322-65111344 CAGATAATGAAAAAGTAGAAAGG - Intronic
1098583836 12:72133274-72133296 CAGTAACAGTGTAAGTAGAATGG + Intronic
1098864176 12:75743326-75743348 CAGTCAAAGCAAAAGTGAATCGG + Intergenic
1099074599 12:78090888-78090910 CAGTAAAAGTGAAAGATGAATGG + Intronic
1099466736 12:82997512-82997534 CAGTCAAAGCAAATATATAAAGG - Intronic
1099715835 12:86292433-86292455 CACTAAAAAAAAAAGTAGTAGGG - Intronic
1100058874 12:90547290-90547312 CTTTAAAAGGAAAAGTAAAAAGG + Intergenic
1100281644 12:93123839-93123861 AAATAAAAAAAAAAGTAGAATGG + Intergenic
1100282719 12:93133531-93133553 CAGTCAAAGAAAAAGCAGACTGG + Intergenic
1100333982 12:93612354-93612376 CAGAAAAAAAAAAAGTACAATGG - Intergenic
1100693870 12:97068843-97068865 CAGTCCAAGCAAAAGTGGACTGG - Intergenic
1100787206 12:98090959-98090981 CAGTCAAAACAAAAGCAGACTGG - Intergenic
1101141341 12:101798942-101798964 CATTACAAGAAAAAGTTGAATGG + Intronic
1102387593 12:112523002-112523024 CAGTCAAAGCAAAAGCAGACCGG + Intergenic
1102614303 12:114139784-114139806 CAGTAAAAGCCATAGGACAAGGG - Intergenic
1103472178 12:121190721-121190743 CAGTAAAAGTGAAAGAAGATAGG - Intergenic
1104167527 12:126248397-126248419 CTGAAAAAGCAAAAGAACAATGG + Intergenic
1106349703 13:28917868-28917890 CAGCAAAAGCAATACTAAAAGGG - Intronic
1106435181 13:29717226-29717248 CTGTAAAAGCAAAAGAACAAAGG - Intergenic
1106676689 13:31967276-31967298 AAGTAAACACAAAAGAAGAAAGG - Intergenic
1106715326 13:32382395-32382417 CAGTAAAAGAAACAGAGGAATGG + Intronic
1106885832 13:34183237-34183259 CAGTTAAGACCAAAGTAGAAAGG - Intergenic
1107149788 13:37098097-37098119 CTGTGAAAGCTAAAGTAAAAGGG - Intergenic
1107172674 13:37361605-37361627 CAATATAAGCAAAAGGATAAAGG + Intergenic
1107222410 13:38000630-38000652 CAGTCAAAACAAAAGCAGACTGG + Intergenic
1107485987 13:40827995-40828017 CATCAGAAACAAAAGTAGAATGG + Intergenic
1107713719 13:43177176-43177198 CAGTCAAAGCCAAAGCAGACTGG - Intergenic
1108166208 13:47695925-47695947 GAGCAGAAGGAAAAGTAGAAGGG - Intergenic
1108215810 13:48183267-48183289 CAGTCAAAGCAAAAGTGGGTTGG + Intergenic
1108300703 13:49072030-49072052 CAACAAAAGCAAAAATAAAATGG - Intronic
1108480413 13:50864470-50864492 AACAAAAAGAAAAAGTAGAATGG + Intergenic
1108692583 13:52872618-52872640 CAGTGAAAGAAAAAGGAGCATGG + Intergenic
1108722090 13:53142535-53142557 CAGTATATGCAAAAGTGCAAAGG - Intergenic
1108949609 13:56074534-56074556 AAGTGAAAGCAGAGGTAGAAGGG - Intergenic
1108979205 13:56489414-56489436 CAGAAAAAAAAAAAGGAGAAAGG - Intergenic
1109318816 13:60784400-60784422 CAATAAAACCAAAATTAAAAGGG - Intergenic
1109465070 13:62720701-62720723 CAATAAAAACAAAACTAAAAGGG - Intergenic
1109489141 13:63072234-63072256 CAGTCAAAGAAAAAGTGGACTGG - Intergenic
1109516657 13:63451566-63451588 CAGTAAAAGCAAGACTAGGAGGG + Intergenic
1110974446 13:81811650-81811672 CAGCAAAAGCAATACTAGGAAGG + Intergenic
1111336399 13:86830307-86830329 CAGTCAAAGCAAAAGTGGATTGG + Intergenic
1111336614 13:86834162-86834184 CAGAAAAGTAAAAAGTAGAATGG + Intergenic
1111499256 13:89094090-89094112 CAGAAAAAGGAAATATAGAAAGG + Intergenic
1111738361 13:92171147-92171169 CAGCAAAAGGAAAAGAGGAAGGG - Intronic
1111826067 13:93269560-93269582 CAGAAAAAGCAAAAGAAGGTGGG - Intronic
1112071717 13:95859365-95859387 AAGTAAAATCAAAATCAGAATGG - Intronic
1112153743 13:96794089-96794111 CAGTAGAAACAAAAGTAGTCAGG - Intronic
1112371971 13:98802160-98802182 CAGACAAAGCAAAAGGAGACTGG - Intronic
1112629208 13:101141834-101141856 CACTATAAGCAAAAGAAAAAGGG + Intronic
1112652949 13:101418357-101418379 TCCTCAAAGCAAAAGTAGAAAGG + Intergenic
1112740004 13:102462280-102462302 AAGTAACAGCAACAGTAGAAGGG - Intergenic
1112744868 13:102515543-102515565 AATTAAAATCAAAATTAGAAAGG - Intergenic
1113127650 13:106997976-106997998 AAGAAAAAGCAAAAGGGGAAGGG + Intergenic
1113242680 13:108355989-108356011 CAGTCAAAGCAAAAGCAGACAGG - Intergenic
1114173511 14:20298099-20298121 CAAGAGAAGCAAAAGAAGAAAGG + Intronic
1114304911 14:21413765-21413787 AAGTAGAAGAAAAAGTGGAATGG - Intronic
1114367878 14:22049578-22049600 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1114569443 14:23656232-23656254 CAGCAAAGGCAAGAGAAGAAGGG + Intergenic
1114873375 14:26685188-26685210 CACTTAAAGCAAAAGTCTAACGG + Intergenic
1114935065 14:27524867-27524889 CAATAAAAGCAAAAATAGGCCGG - Intergenic
1115016002 14:28615046-28615068 CAGTAAAATGAAAACTTGAAAGG - Intergenic
1115037388 14:28874964-28874986 CAGTAAAAACAAAAACAAAATGG - Intergenic
1115055731 14:29124172-29124194 CAGTAAATGCACAAGGAAAAAGG + Intergenic
1115823104 14:37233911-37233933 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1116403468 14:44538874-44538896 CAACAAAACCAAAAGTGGAAAGG + Intergenic
1116621373 14:47208245-47208267 CAGCAAAAGCAAAGGTAGCCAGG + Intronic
1117026546 14:51626217-51626239 CAGTAAAGAGAAAAGGAGAATGG - Intronic
1117166164 14:53036112-53036134 CAGCAAATGCAAAGGTAGAGAGG + Intergenic
1117275019 14:54184694-54184716 CAGCAAAAGGAAAAGGAGAAAGG + Intergenic
1117689177 14:58287771-58287793 CAGTCAAAGCAAAAGCAGGCTGG - Intronic
1117859138 14:60071559-60071581 GTGTAGAAGCAAAAGTATAAGGG + Intergenic
1117933837 14:60878698-60878720 CAGTCAAAGCAAAAGTGGACTGG - Intronic
1118012014 14:61619158-61619180 CATTAAAACAAAAAGTAGAATGG + Intronic
1118221566 14:63859348-63859370 AATTAAACCCAAAAGTAGAAGGG - Intronic
1118430238 14:65711411-65711433 AAGTAAAAGCAAAATTAGTAGGG - Intronic
1118804392 14:69222541-69222563 CAGAAAAGGAAAAAGTAGAAAGG - Intronic
1118853870 14:69606178-69606200 AAGGAAAAGCCAAGGTAGAAAGG - Intergenic
1119011178 14:70990766-70990788 CAGGAAAAGGCAAAGTAGAAAGG - Intronic
1119117223 14:72035610-72035632 CAGCAAAAGCAATACTAGGAAGG - Intronic
1119936510 14:78597052-78597074 CAGAAAAAGAAAAAGTAAAGAGG - Intronic
1119965362 14:78909294-78909316 CAATCAAAGCAAAAGCAGACTGG + Intronic
1120806358 14:88755339-88755361 CAGTGAAAGGAATAGTAAAATGG - Intronic
1120972917 14:90223690-90223712 CAACAAAAGCAAAAATAGCATGG + Intergenic
1121370422 14:93353141-93353163 AAGTAAAAGGAAAAATAGCAGGG - Intronic
1121641736 14:95489190-95489212 CAGTAAAAGCAGAAGACAAATGG + Intergenic
1121891391 14:97594598-97594620 CTGTAAAAGCACAAATAAAAAGG - Intergenic
1123173423 14:106396048-106396070 CAGGAAAAGCAAATGAAAAAGGG + Intergenic
1124079924 15:26483346-26483368 CAGAAAAAGCAAAAATATGACGG + Intergenic
1125917112 15:43497682-43497704 CAGAAAGAGAGAAAGTAGAATGG + Intronic
1126278383 15:46912957-46912979 CAAGAAAAGCAAAAGTAAATAGG + Intergenic
1126392628 15:48176486-48176508 CAGGAAAAGAGAAAGGAGAAAGG - Intronic
1126666404 15:51079179-51079201 CAGAAAATGCAAAAGTGCAAGGG - Intronic
1126874260 15:53022537-53022559 CAGAAAAACCAAAAGAAAAAAGG + Intergenic
1126892356 15:53219980-53220002 CATGGAAACCAAAAGTAGAATGG - Intergenic
1127113926 15:55705456-55705478 CACAAAAAGAATAAGTAGAAAGG - Intronic
1127202888 15:56676398-56676420 CAGAAAAAGAAAAAGTTGAGTGG - Intronic
1127410705 15:58703790-58703812 CAGTCATAGCAGAAGGAGAAGGG - Intronic
1127541129 15:59940014-59940036 CAGTAAAAGCAAAACTAGCTGGG + Intergenic
1127653974 15:61038161-61038183 CATTAATAGCAAAAGAAGAATGG + Intronic
1129080102 15:73032116-73032138 CAGTAAATGCAACAGGGGAAAGG + Intergenic
1129460022 15:75695923-75695945 AAGTAGAGGGAAAAGTAGAATGG + Intronic
1129486445 15:75878102-75878124 AAGTAAAAGCCATAGTATAAAGG - Intronic
1130710750 15:86278644-86278666 CAGTAAAACCAAAAGCACAATGG + Intronic
1130739867 15:86587560-86587582 CAGTATAAGCAAAGGCATAAAGG + Intronic
1131240454 15:90737665-90737687 CAGTGAAAGCAGTACTAGAAAGG + Intronic
1131561195 15:93441736-93441758 GTGTAAAAGCAAAACTTGAAAGG + Intergenic
1131671796 15:94627490-94627512 CAGGAGAAGAAAAAGTTGAAGGG + Intergenic
1131798962 15:96049827-96049849 TAGTAAGAGCAAATGTATAAGGG - Intergenic
1131940700 15:97561873-97561895 CAGAGACAGCAAAAGTAGCATGG - Intergenic
1132213064 15:100040265-100040287 CAGTAAGGGCAACAGTGGAAGGG - Intronic
1132334980 15:101042519-101042541 CAGTAAAAGCCACAGGAGGATGG - Intronic
1133573575 16:7065834-7065856 TCATAAAAGCAAGAGTAGAATGG - Intronic
1133722078 16:8504105-8504127 CAGTCAAAGTAAAAGTGGACTGG - Intergenic
1135848236 16:25938728-25938750 CAGTAAAAGGGGAAGTAGACAGG - Intronic
1136099666 16:27984506-27984528 CAACAGAAGCAAAAGTAAAATGG + Intronic
1137030965 16:35524027-35524049 CAATTAAATCAAAAGCAGAAAGG + Intergenic
1138132030 16:54488336-54488358 CAGTGCAAGCAAATCTAGAATGG + Intergenic
1138150882 16:54655650-54655672 AAGAAAAAGCAGAAGTGGAAAGG + Intergenic
1138300667 16:55926848-55926870 CAGTCAAAGCAAAAGCAGACTGG - Intronic
1138771615 16:59671336-59671358 CAGTCAAACCAAAAGCAGACAGG + Intergenic
1139024732 16:62801727-62801749 GAGTGAATGCAAAAGCAGAAAGG - Intergenic
1139064536 16:63296294-63296316 TAATAAAAGCAAAAATTGAAGGG + Intergenic
1139097728 16:63725804-63725826 CAGTCAAAGCAAAAGTGACATGG + Intergenic
1139114371 16:63931665-63931687 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1140546428 16:75814385-75814407 AAGTAAAAGACAAAGTAGCATGG - Intergenic
1143277681 17:5723948-5723970 TTTTAAAAGCAAAAGCAGAAAGG + Intergenic
1143277682 17:5723972-5723994 TTTTAAAAGCAAAAGCAGAAAGG + Intergenic
1144146236 17:12401246-12401268 CAGGATAAACAAAAGGAGAAAGG + Intergenic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1145027588 17:19480138-19480160 CACTAAAAGCACAAGCAAAAAGG - Intergenic
1145828559 17:27896680-27896702 GAGAATAAGTAAAAGTAGAAGGG + Intergenic
1147780260 17:42935813-42935835 ACATAAAAGGAAAAGTAGAAGGG - Intergenic
1148140269 17:45323207-45323229 CAGGAAACCCAAAGGTAGAAGGG - Intergenic
1149215685 17:54351163-54351185 CAAGAAAAACAAAAGAAGAAAGG + Intergenic
1149464905 17:56870443-56870465 CTGTCAAAGCAAAATTAAAATGG - Intergenic
1150297078 17:64017128-64017150 CAGTAAAAGGAAAGGAAGGAAGG + Intronic
1153274665 18:3356285-3356307 CAATAAAAGCAAAAATAAACAGG + Intergenic
1153422318 18:4920720-4920742 CAGCGAAAGCAAAACTAGACAGG + Intergenic
1153481728 18:5554113-5554135 CAGTAAAAGCAAAACTGTGACGG + Intronic
1154144156 18:11852224-11852246 CTGTAAACCCAAAGGTAGAAGGG - Exonic
1154985655 18:21548495-21548517 CAAAAAAAGCAAAAATAAAAAGG + Intronic
1155006346 18:21733011-21733033 CAGTCAAAGCAAAAGTGGACCGG - Intronic
1155523852 18:26696833-26696855 CAGTATTAGCATAAATAGAAAGG - Intergenic
1155731824 18:29169356-29169378 CAGTAAAAGCAATACTAAGAGGG - Intergenic
1155825299 18:30434874-30434896 CAGTAAAAGCCAAATGATAATGG + Intergenic
1155883080 18:31174511-31174533 CAGTAAAAGTAAATGTTAAAAGG + Intergenic
1156202887 18:34854484-34854506 CAGAAAGAGCTAAAGAAGAAAGG + Intronic
1156255280 18:35389473-35389495 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1156635270 18:39020321-39020343 CAGTAAGAGGAAAAGAAGAGAGG - Intergenic
1156709973 18:39931588-39931610 CAAAAAAATGAAAAGTAGAATGG - Intergenic
1156802919 18:41139938-41139960 CAGAAAAAGCAAAAGAAAATGGG + Intergenic
1157666931 18:49495162-49495184 CAGCAACAGAAAAAGAAGAAAGG - Intergenic
1158304808 18:56093675-56093697 CAATAAAGGCAATAGTAAAAAGG + Intergenic
1158318187 18:56235318-56235340 CAGTAAGAGGAAAACTAGATGGG + Intergenic
1158516489 18:58134718-58134740 GATTAAAAGAAAAAATAGAAGGG - Intronic
1159041768 18:63330840-63330862 CAGTATAAGCAAAATTGGAAAGG + Exonic
1159357160 18:67350998-67351020 GAGGAAAAGCATAAGAAGAAAGG - Intergenic
1159410603 18:68071031-68071053 CAGTGCAAGAAAAAGTAGCATGG + Intergenic
1159461670 18:68728848-68728870 TAGTAAAAGAAAAAAGAGAAAGG + Intronic
1159472634 18:68878016-68878038 AAGTAAAAGCAAAATAAGAATGG + Intronic
1159855624 18:73584112-73584134 AATTACAAGAAAAAGTAGAATGG + Intergenic
1159904065 18:74074891-74074913 CAGTGAAATCTAAAGTGGAAAGG - Intronic
1159972846 18:74675166-74675188 CAGAGAAAGCATAAGTATAAAGG - Intronic
1160734565 19:656645-656667 CAGAAAAAGAAAAAGAAAAAGGG + Intronic
1163669974 19:18621723-18621745 AAGAAAAAGAAAAAGTAGACCGG - Intergenic
1163877537 19:19885910-19885932 AATTAAAAGCAAAAGTCAAATGG - Intronic
1163995287 19:21039760-21039782 AATTAAAAGCAAAAGTAGGCCGG - Intronic
1164486699 19:28662994-28663016 CAGTAAAAGTAGCAGTAGGAAGG - Intergenic
1164886056 19:31779641-31779663 AAGAAAAAAAAAAAGTAGAAGGG - Intergenic
1165177350 19:33939970-33939992 AAGTAAAAACAAAATTAGCAAGG - Intergenic
1165245525 19:34496492-34496514 CAGGAAAAGGACAGGTAGAATGG - Intronic
1165423996 19:35735752-35735774 CAGCGAAGGCAAAAGAAGAATGG - Intronic
1166965086 19:46524985-46525007 CAGAAAAAGAAAAAGAAGGAAGG - Intronic
1168648723 19:58079039-58079061 CATTCAAAGCAATAGTAAAAAGG - Intronic
925228340 2:2206319-2206341 CAATAAAAGAAAAAGGTGAATGG - Intronic
925717560 2:6798258-6798280 CAGGAAAAGCAAAATGAGGAGGG + Intergenic
926244762 2:11114348-11114370 TAATAAAAGCAAAAGTAAACAGG - Intergenic
926406197 2:12555437-12555459 AAATAAAAGCAAAAATAGGAAGG + Intergenic
926759935 2:16269458-16269480 CAGAAAGGGCAAAAGTAAAATGG - Intergenic
926824418 2:16889694-16889716 AAGGAAAAGCCAAAGTAGAAAGG - Intergenic
926837959 2:17045178-17045200 CAGTCAAGGCAAAAGGTGAAGGG + Intergenic
927057749 2:19382679-19382701 CAGTCAAAGTAAAAGTGGACTGG - Intergenic
927569568 2:24146056-24146078 CTGTAAAAGCAAAATTATACTGG + Intronic
928172767 2:29014024-29014046 CAGGAAAAGAAAAAGCAAAATGG - Intronic
928209614 2:29313821-29313843 GAGGAAAAACAAAAGCAGAAGGG - Intronic
928321065 2:30283218-30283240 AAGTAAAAGCAAAGGAAGAGTGG - Intronic
928486006 2:31732515-31732537 CAGCAAAAGCAATACTAAAAGGG + Intergenic
928627423 2:33154609-33154631 TGATAACAGCAAAAGTAGAAAGG - Intronic
928728075 2:34198655-34198677 CAGTCAAAGCAAAAACAGAGTGG + Intergenic
928829149 2:35457969-35457991 CACCAAAAGCAAAAATTGAAAGG + Intergenic
928835824 2:35543451-35543473 CCATAGAAGCAAGAGTAGAATGG + Intergenic
928854169 2:35784320-35784342 CAAGTAAAGCAGAAGTAGAATGG - Intergenic
929065331 2:37967474-37967496 CAATCAAAGCAAAAGCAGACTGG + Intronic
929397361 2:41538749-41538771 CTGTAAAACCAAAAGTAAAGAGG + Intergenic
930109250 2:47664612-47664634 AGGCAAAAGCAAAAGTAAAAAGG - Intergenic
930455893 2:51606806-51606828 CAGTAACAGAAAAAGTTGGATGG + Intergenic
930895034 2:56436012-56436034 AAAAAAAAGAAAAAGTAGAAAGG - Intergenic
931041116 2:58301842-58301864 CAATAATAGCAAAAATAGATTGG + Intergenic
931736596 2:65199814-65199836 CAGGAAAGGGAAAAGAAGAATGG + Intergenic
932178790 2:69626802-69626824 AAGTAAAATTAAAAGAAGAAGGG - Intronic
932455367 2:71846184-71846206 CAGTAAAAGTAAAAGGATCATGG + Intergenic
935415514 2:102813217-102813239 AAGTAAACACAAAAGAAGAAGGG - Intronic
935499635 2:103822301-103822323 CAGTAAAAAAAAATATAGAATGG + Intergenic
935526039 2:104168399-104168421 CGGTAAAAGCAAAAGGAGCTAGG + Intergenic
936799665 2:116252131-116252153 CAGCTAAAGCTAAAGTGGAAAGG + Intergenic
937162120 2:119774261-119774283 CATTACAAGAAAAAGTTGAATGG + Intronic
937486157 2:122316856-122316878 CAGGAGAGGCAAAAGAAGAAAGG - Intergenic
938319333 2:130352587-130352609 AAGTTAAAACAAAAGTGGAAGGG - Intergenic
938677152 2:133648739-133648761 CAGCAAAAGCAATACTAAAAGGG + Intergenic
938784723 2:134616105-134616127 AAGTCAAAGCAAAAGTGGACTGG + Intronic
939039042 2:137165949-137165971 CATTAAGAAAAAAAGTAGAAAGG + Intronic
939198749 2:139007116-139007138 CAGTAAAAGCAAAAGCAGACTGG + Intergenic
939585506 2:143999421-143999443 CCTTAAAAAAAAAAGTAGAAAGG + Intronic
939817799 2:146917552-146917574 GAGTAAAAGCAAAAGCAAGAAGG + Intergenic
939836916 2:147140976-147140998 CAGAAAAGGCAAAAGTATAAGGG + Intergenic
939984818 2:148819401-148819423 TAGTCAAAGCAAAAGCAGACAGG + Intergenic
940072186 2:149701266-149701288 CAGTAAATGGAAAATGAGAAAGG - Intergenic
940392487 2:153148625-153148647 AAGGAAAGGCAAAATTAGAAAGG + Intergenic
940559570 2:155277950-155277972 CAGCAAAAGCAATAGTAAGATGG - Intergenic
940692163 2:156932364-156932386 CAGTAAAGTACAAAGTAGAAGGG + Intergenic
941211548 2:162646352-162646374 CAGTAAAAGAATAGGTAGAGAGG - Intronic
941388688 2:164884807-164884829 CTGTAAGAGATAAAGTAGAAGGG - Intergenic
941637622 2:167952411-167952433 GAGCAAAAGCAAAAATAAAATGG - Intergenic
941789220 2:169532811-169532833 CAGGAAAAGCAAAGGTATAGGGG + Intronic
941963720 2:171279727-171279749 CATTAAAAGAAAAAGTTGAATGG + Intergenic
942373734 2:175313900-175313922 TAGTAAAACCAAAAGAATAAAGG - Intergenic
942844218 2:180403670-180403692 TAGTCAAAGCAAAAGTGGACTGG + Intergenic
943499385 2:188667800-188667822 GAATAAAACCAAAAGGAGAAAGG - Intergenic
943633061 2:190276105-190276127 CAGTCAAAGCACAAGCAGACTGG + Intronic
943823348 2:192356246-192356268 AAGGGAAAGCAATAGTAGAAGGG + Intergenic
943914582 2:193613618-193613640 CAGTCAAAGCAAAAACAGACTGG - Intergenic
944291452 2:198011261-198011283 CAGTGAAAGCAGTAGTAAAAGGG - Intronic
945137061 2:206640872-206640894 CAGTACAAGCAAAGGCAGGAAGG - Intergenic
945320351 2:208414488-208414510 CAGAAAAAGAAATAGTACAATGG - Intronic
945505131 2:210630382-210630404 CAGTAAAATCAACATTAAAAAGG - Intronic
945895866 2:215480951-215480973 TAATAAGAACAAAAGTAGAATGG + Intergenic
946118550 2:217487796-217487818 CTTTAAATGCAAAAGAAGAAAGG + Intronic
946151555 2:217776280-217776302 CAGTCAAAGCGAAAGCAGACTGG - Intergenic
947032244 2:225809869-225809891 CAGTCAAAGCAAAAGCAGACCGG - Intergenic
947034083 2:225831225-225831247 CAGTCAAAGCAAAAGCAGATGGG + Intergenic
947057171 2:226118329-226118351 TAGTAAAAATAAAAGTAAAAGGG + Intergenic
947355549 2:229291251-229291273 GAATCAAAGCAAAAGTAGACTGG + Intergenic
947480563 2:230495752-230495774 CAAGAGAAGCATAAGTAGAATGG - Intronic
947887653 2:233587109-233587131 CAGTCAAATCAAAAGCAGACTGG - Intergenic
947893828 2:233649830-233649852 CAGTCAAATCAAAAGCAGACTGG - Intronic
948514227 2:238493447-238493469 AAGAAAAAGAAAAAGAAGAAGGG - Intergenic
1169298693 20:4423155-4423177 CACTAAAAGCAAAGGAACAAAGG + Intergenic
1169949621 20:11029027-11029049 GAGTATAAGAAAAAGGAGAAAGG - Intronic
1170093607 20:12620476-12620498 CAGTAAAAGCAGAAATCCAAAGG - Intergenic
1170278621 20:14620810-14620832 AAATTAAAGAAAAAGTAGAAAGG - Intronic
1170721532 20:18884391-18884413 CAACAAAAGCAAAAATAGACAGG - Intergenic
1172344089 20:34183281-34183303 CAGTAAAAGAAAAAGTACAGAGG + Intergenic
1172926547 20:38542172-38542194 CAGAAAATGTAAAAGCAGAAAGG + Intronic
1173235873 20:41244897-41244919 CAGGAAAAGCAAAAGGAGTTGGG + Intronic
1173416155 20:42857917-42857939 CAGAAACAGAAAAAGTAAAAAGG - Intronic
1173633679 20:44535995-44536017 CATAGAAAACAAAAGTAGAATGG - Intronic
1173692978 20:44979780-44979802 CAGTAATCACAAAAATAGAAGGG - Intronic
1177519257 21:22196112-22196134 CAAGAAAAGTAAAAGTAGACTGG - Intergenic
1177685146 21:24426512-24426534 CAGTCAAAGCAAAAACAGACTGG - Intergenic
1178744986 21:35240346-35240368 CAGAAAAAGCAAAAGAAAAAGGG + Intronic
1178997727 21:37420501-37420523 CAGTAAATGCAAAGGTAGTTGGG + Intronic
1179523561 21:41960909-41960931 CAATAAAAACAATAGTAGAAAGG - Intergenic
1179609758 21:42542525-42542547 CAGAAAAACTAAAAGTAAAATGG - Intronic
1179966036 21:44806402-44806424 CAGTATATGGAAAAGTTGAAGGG - Exonic
1180572137 22:16735527-16735549 GAGTAAAATAAAAAGAAGAAAGG - Intergenic
1180578340 22:16803157-16803179 AAGTATATGCAAAAGTGGAAAGG - Intronic
1180903907 22:19395075-19395097 CTATAAAAGGAACAGTAGAAAGG + Intronic
1181976671 22:26735854-26735876 TGGTAAAAGTAAAAGTAGATGGG + Intergenic
1182014382 22:27026738-27026760 CAGTAACTGCAAAGGCAGAAAGG + Intergenic
1183644993 22:39120184-39120206 CATTAAAAAAAAAAGAAGAAAGG - Intronic
1184420180 22:44376407-44376429 CAGTAAATGCAAAAATGCAAGGG - Intergenic
949112118 3:273834-273856 CAGTATAGGCAAGAGTAGATTGG - Intronic
949385055 3:3491913-3491935 CAGTAAAAAGAAAAAAAGAAAGG + Intergenic
949724484 3:7027547-7027569 CAGTAAAAGAAAAACAAAAAAGG - Intronic
950960649 3:17102601-17102623 CAGTAAAAGTAATACTAAAAGGG + Intergenic
951297447 3:20956212-20956234 CAGTCAAAGCAGAAGCAGACAGG + Intergenic
951591451 3:24269908-24269930 CAGAAAAAGCCAAAGAAGGAAGG - Intronic
951618554 3:24575667-24575689 CAGGAAAAGAAAAAGGAGATTGG + Intergenic
952647928 3:35684590-35684612 CAGTCAAGACAAAAGTAAAATGG + Intronic
953502717 3:43453477-43453499 CAATAAAAGAAAAAGAAGATAGG - Intronic
953587132 3:44212538-44212560 CATTAAAACCAAATGTGGAAAGG + Intergenic
955079156 3:55641716-55641738 CAGTAGAAGGAAAAGGAGAGAGG - Intronic
955578473 3:60392795-60392817 CAGTAAAACCAAAGGTGGACTGG + Intronic
955900531 3:63748949-63748971 CAGGAAAAGCAAATGTAGAATGG - Intergenic
956091278 3:65669553-65669575 TAGTCAAAGCAAAAGCAGACTGG - Intronic
956402417 3:68894795-68894817 CAGTAAAAGTAAAGATGGAAAGG + Intronic
956846410 3:73187633-73187655 CAATAAAAGAAAAAGAAGAGGGG - Intergenic
956931108 3:74043990-74044012 AATTAAAAGCTAAAGTTGAAAGG - Intergenic
956989816 3:74750734-74750756 CAGTAAAATCTAAAGTGGAAGGG + Intergenic
957239970 3:77646705-77646727 CAATAAAAAAAATAGTAGAAAGG + Exonic
957337108 3:78845382-78845404 CAATAAAAGGAAAAGGAAAAAGG - Intronic
957884246 3:86263529-86263551 AAGGAAACACAAAAGTAGAATGG - Intergenic
958259649 3:91365738-91365760 CATTTAAAGCAAAAGAAGGAAGG + Intergenic
958513346 3:95078296-95078318 CTGAAAAAGCAAGACTAGAAAGG - Intergenic
959007113 3:101032396-101032418 CAGTCAAAGCAAAAGTAGACTGG + Intergenic
959174158 3:102884264-102884286 AAGAAAAAGGAAAAGAAGAAAGG - Intergenic
959248367 3:103904963-103904985 CAGAAAAAGGAAAAGTAAGAAGG + Intergenic
959503471 3:107132986-107133008 CATCAGAAGCAAAAGTAAAACGG + Intergenic
959563665 3:107812468-107812490 CAGTATATGCAGAAGTAGAGAGG + Intergenic
959811971 3:110630061-110630083 GCTTAAAAGCAAAACTAGAAAGG - Intergenic
959877579 3:111403194-111403216 CAGCAAAAGCAGAATTAAAAGGG - Intronic
959937123 3:112040752-112040774 CAGTACAAGCAAAGGGAGACTGG + Intronic
960043168 3:113170671-113170693 CAGCAAAAAGAAAAGCAGAATGG + Intergenic
960470156 3:118054487-118054509 CAGTAACAGCAAAACTGGACAGG + Intergenic
960529136 3:118743711-118743733 AAGAAAAAGAAAAATTAGAAAGG + Intergenic
960856240 3:122105028-122105050 AAGCAAAAGTAAAAATAGAATGG + Intronic
961121060 3:124370549-124370571 CTGTCAAAGCAAAAGCAGACTGG - Intronic
961928967 3:130513599-130513621 TAGTCAAAGCAAAAGCAGACAGG + Intergenic
961953284 3:130772818-130772840 AATTAATAGCACAAGTAGAAAGG + Intergenic
962030450 3:131594674-131594696 TAATAAAAGCAAAAATAGATAGG + Intronic
962312017 3:134333542-134333564 CAGTGATCGCAAAAATAGAATGG - Intergenic
963028135 3:140940621-140940643 CAGTCAAATCAAAAGTAGACTGG + Intergenic
963297550 3:143562385-143562407 CAGTAAGAGCAAAGGGAGAGAGG + Intronic
963466008 3:145684452-145684474 CTTTAAAAGCAACAGTAGATTGG - Intergenic
963558942 3:146835567-146835589 AAGCAAAAGCAAAAGAGGAAGGG + Intergenic
963608161 3:147431319-147431341 CAGAAAAAGCAAAACAAGACTGG + Intronic
963853314 3:150228488-150228510 AAGGAAAAGCAAAACTGGAAGGG - Intergenic
963888372 3:150605310-150605332 CAAAAAAAGCAAACGTAAAAGGG - Intronic
964394730 3:156233624-156233646 CAGCAAGGGCAAAAGCAGAAAGG + Intronic
964401984 3:156309542-156309564 CAGTAAAGGTAAAAGCTGAAAGG - Intronic
964420626 3:156498964-156498986 CAGTCAAAGAAAAAGCAGACTGG + Intronic
964598182 3:158461930-158461952 CAGTAAAACCCAAAGTATAATGG + Intronic
964821077 3:160770442-160770464 AAGTAAGAGCCAAAGAAGAAAGG + Intronic
965248510 3:166309064-166309086 GAGTAAAAGCAAAAGGAAAATGG + Intergenic
965249273 3:166321521-166321543 AAGTAGCATCAAAAGTAGAATGG + Intergenic
966565206 3:181372106-181372128 AAGAAAAAGCAAAATGAGAAGGG + Intergenic
966972521 3:185058353-185058375 CAATAAAAGCAAAAATAAATAGG + Intergenic
967662152 3:192125908-192125930 AATTAAAAGCAAAAGTAAAAAGG - Intergenic
968407095 4:350310-350332 CATAGAAAGCAGAAGTAGAAAGG - Intronic
968607278 4:1541453-1541475 CAGTAAAAACTAAAATAAAAAGG - Intergenic
970050801 4:11912909-11912931 CAGTAAAACCAAAATAATAAAGG + Intergenic
970453470 4:16196586-16196608 CATTAAATGCAAAAGTAAACAGG - Intronic
970466239 4:16325855-16325877 CAGAAAAAGCAGAAGCAGAGAGG + Intergenic
970638317 4:18035303-18035325 CAGTTAAAGGAAAAGAGGAAGGG - Intergenic
970681362 4:18512253-18512275 CAGTGAAAGCTAAAAAAGAAGGG - Intergenic
970723969 4:19021020-19021042 CTGTAAAAGCAAAAGTGAGATGG - Intergenic
970753129 4:19390143-19390165 AAATAAAATCAAAAATAGAAAGG + Intergenic
970885210 4:20980106-20980128 CAGTAGAAGCACAGGTAGAAAGG - Intronic
971109578 4:23569721-23569743 CAGAATAAGCAAAATTAAAATGG - Intergenic
971797512 4:31247243-31247265 CAGCAAAAGCTATAGTAGGAGGG + Intergenic
971860292 4:32093127-32093149 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
971943861 4:33249886-33249908 CAGAAAAAGAGAAAGTGGAAAGG - Intergenic
972034025 4:34497722-34497744 AAATAAAAGCAATAATAGAATGG + Intergenic
972313727 4:37905737-37905759 CAGTCAAAGCGAAAGTGGACTGG - Intronic
972332741 4:38078990-38079012 CAGTAGAAACAGAAGCAGAAAGG + Intronic
972504813 4:39711027-39711049 CAGTAAAAACAAAAATATGAAGG - Intronic
972518801 4:39834233-39834255 CAGTGAAAGGAAAAGCAGACTGG + Intronic
972583672 4:40417373-40417395 CAGGAAAAAAAAATGTAGAAAGG + Intergenic
973074508 4:45905430-45905452 CAGTAAAATCAGAAGCAAAAAGG + Intergenic
973999928 4:56501820-56501842 CAGCAACAGAAAAAGAAGAAAGG + Exonic
974382189 4:61155159-61155181 CAGTAAAAGAACAAAAAGAAAGG + Intergenic
974544750 4:63286977-63286999 CACAGAAAGCAAGAGTAGAATGG - Intergenic
974909320 4:68097406-68097428 CAACAAAAGCAAGAGGAGAATGG - Intronic
975127215 4:70796327-70796349 CAATCAAAGCAAAAGCAGACGGG - Intronic
975198802 4:71560207-71560229 AAGAAAAAGAAAAAGAAGAAGGG + Exonic
975206840 4:71653918-71653940 TAGTCAAAGCAAAAGTGGACTGG - Intergenic
975431718 4:74300016-74300038 CAGTTAGAGCAAAGGAAGAAAGG + Intronic
975503030 4:75108581-75108603 CTGAAAAAGCAAAAGAAGAAAGG + Intergenic
975653373 4:76616633-76616655 CATTGAGAGAAAAAGTAGAATGG + Intronic
975981379 4:80163636-80163658 CAATAAAAGCAAAAATAAACTGG + Intergenic
976528580 4:86122389-86122411 CAGTTAAAGCAAAAGTGAACTGG - Intronic
976841963 4:89442205-89442227 CAGTCAAAGCAAAAGTGGACTGG - Intergenic
977078534 4:92490945-92490967 AAATAAAAACAAAAATAGAATGG + Intronic
977145193 4:93430900-93430922 GAGTAGAAGTAAAGGTAGAAAGG + Intronic
977300279 4:95259919-95259941 CATTAAAAGAACAAGTAGACTGG - Intronic
977775612 4:100916112-100916134 CTGTAAAAGCAAGACTTGAAAGG - Intergenic
979226631 4:118293314-118293336 TATTAAAAGCAAAACTATAAAGG + Intronic
979291588 4:118984474-118984496 GAGTAAAGGGAAAAGTAGAAGGG - Intronic
979342431 4:119542200-119542222 CAGAAAAAGCAAAGGCATAAAGG + Intronic
980254409 4:130359259-130359281 CAGTAAAAGATAAAGGAGAAAGG + Intergenic
980439297 4:132818903-132818925 CAGAAAAACAAAAAGTACAATGG - Intergenic
980603332 4:135055564-135055586 AAGAAAAAGAAAAAGAAGAAAGG - Intergenic
980699737 4:136409615-136409637 CTGTTAAAGCAAAAGTAGCATGG + Intergenic
980772314 4:137392020-137392042 CAGTAAAAACGGAAGTAGAAAGG + Intergenic
980841715 4:138269444-138269466 CATTGAAAACAAAAGGAGAATGG + Intergenic
981669042 4:147264651-147264673 GGGAAAAAGCAAAAATAGAATGG - Intergenic
982045511 4:151441315-151441337 CAAAAAAAAAAAAAGTAGAAAGG - Intronic
982532281 4:156559891-156559913 CAGCAAAAGCAATACTAGGAAGG - Intergenic
982973082 4:162015753-162015775 GAGTAAAGAAAAAAGTAGAAAGG - Intronic
983352963 4:166617450-166617472 CAGCAAAAGCAATACTATAAGGG + Intergenic
984061752 4:174997282-174997304 CTGTCAAAGCAAAAGCAGATTGG - Intergenic
984421524 4:179528439-179528461 CAGTCAAAGCAAAAACAGACCGG - Intergenic
984428563 4:179619563-179619585 CAGTAAAAGAAAAAGTGAGATGG - Intergenic
984459197 4:180011517-180011539 AATTAAAAGCAAAAGGAGAATGG - Intergenic
986934665 5:12868007-12868029 AAGTAAAAGCAAGTGGAGAAGGG - Intergenic
987157302 5:15102573-15102595 CATTAAAACCAAAAGGACAAGGG + Intergenic
987286313 5:16461289-16461311 AAGTAAAAGCCAAAGTATAATGG - Intronic
988145143 5:27295793-27295815 AAGTAAAAGTAAAAAGAGAATGG + Intergenic
988236643 5:28554182-28554204 CAGTAAAAACAGTACTAGAAGGG - Intergenic
988316799 5:29641726-29641748 CAGTCAAAGCAAATGTAGACTGG - Intergenic
988495283 5:31740058-31740080 CAGCCAAAGCAAAAGCAGATGGG - Intronic
988729460 5:33956408-33956430 CAGTCAAAGCAAAAGCAGACAGG + Intronic
989093927 5:37763556-37763578 CAGGAAAAGCAGAGGAAGAAGGG + Intergenic
989173311 5:38494688-38494710 CAGTAAAAACAAACATAGAAAGG + Intronic
989265604 5:39470198-39470220 CTATAATAGAAAAAGTAGAAAGG - Intergenic
989504552 5:42212255-42212277 CAGCAAAAGCAATATTAGAAGGG - Intergenic
989654298 5:43728871-43728893 CAAAAAAAGCAAAAGCACAAAGG - Intergenic
989675920 5:43972433-43972455 AAGTAAAAGCCATAGTACAATGG + Intergenic
989786737 5:45341586-45341608 CAGTCAAAGCAAAAGCAGACTGG + Intronic
989948500 5:50268930-50268952 CAGTAACAGAAGAAGAAGAAAGG + Intergenic
990393267 5:55350037-55350059 CAGTCAAAGCAAAAATACACTGG - Intronic
990758972 5:59107598-59107620 CAGTAGAAGGAGAAGTAGAGGGG + Intronic
991153150 5:63396211-63396233 CAAAAAGAGCAAAAGAAGAACGG + Intergenic
992039134 5:72811704-72811726 CAATAAAAGAAAAAGTAAACAGG - Intergenic
992170880 5:74100877-74100899 CAGTGAAAGGAAAAGCAGACTGG - Intergenic
992193728 5:74319001-74319023 AGGAAAAAGCAAAAGTAAAAAGG - Intergenic
992930927 5:81644262-81644284 AAATAAAAACAAAAATAGAAAGG - Intronic
992999690 5:82368137-82368159 CAGTAAGAGGGAAAGTAGAATGG - Intronic
993543565 5:89182739-89182761 AAATAAAAGAACAAGTAGAAGGG - Intergenic
993727772 5:91388191-91388213 AAATAAAAACAAAAATAGAATGG - Intergenic
994384811 5:99118702-99118724 CAGTCAATGCAAAAGTGGACTGG + Intergenic
994703344 5:103166125-103166147 CAGTCAAAGCAGAAGCAGACTGG + Intronic
995227508 5:109718279-109718301 CAGAAAAAGGAAAAGAATAAAGG - Intronic
995235861 5:109829531-109829553 CAATCAAAGCAAAAGAAGACTGG - Intronic
995486551 5:112645582-112645604 CAAAAAAAAAAAAAGTAGAATGG + Intergenic
995577823 5:113559880-113559902 CAGTCAAAGCAAAAGCGGACTGG + Intronic
995918778 5:117284952-117284974 CAGAAAATGAAAAATTAGAATGG - Intergenic
996129546 5:119765118-119765140 GAGAAAAAGCAAAAGGGGAATGG - Intergenic
996217778 5:120890411-120890433 CAACAAAAGCAAAAATACAAAGG - Intergenic
996622673 5:125527816-125527838 CGGAAAAAGAAAAAGTAAAATGG - Intergenic
996735804 5:126756956-126756978 CAGTCAAAGCAATGGAAGAAAGG - Intergenic
997224769 5:132201159-132201181 GAGTAAAGGCAAAATTAAAAAGG + Intronic
997489514 5:134261941-134261963 CACAAAAAGCAAAAGCAAAAAGG - Intergenic
998253936 5:140570800-140570822 CAGTATAAGCAAAAGTTCAGAGG - Intronic
998329859 5:141315865-141315887 AAGTAAAATCAAAAGTAGCAAGG + Intergenic
998789914 5:145755168-145755190 CAGTCAAAGCACAAGCAGACTGG + Intronic
998823847 5:146081521-146081543 CAGAAGAAGCAAAAGGGGAAAGG + Exonic
998835516 5:146199579-146199601 TAGTCAAAGCAAAAGCAGACTGG + Intergenic
999015312 5:148097060-148097082 AAGAAAAAGAAAAAGGAGAAAGG - Intronic
999409109 5:151334715-151334737 AAATAAAAGAAAAATTAGAAAGG + Intronic
999579702 5:153023416-153023438 GAGTCAAAGAAAAAATAGAAGGG + Intergenic
999704854 5:154262853-154262875 CAGGAAAGGCAAAAGAAGACTGG + Intronic
999896131 5:156035630-156035652 TAATAAAAACAAGAGTAGAATGG + Intronic
1000527522 5:162376859-162376881 CAGTAAGAGCTAAAGAAAAAGGG - Intergenic
1000840850 5:166216332-166216354 GAGAAAAAGCATAAGAAGAAAGG + Intergenic
1000855574 5:166394089-166394111 GAGAATAAGCAAAAGTATAAAGG - Intergenic
1000940889 5:167358461-167358483 CAGAAAAAAAAAAAGAAGAAAGG - Intronic
1000943678 5:167394138-167394160 CAATAAAAGCAAAAATAGGTGGG - Intronic
1001947898 5:175796080-175796102 CAGATAAAGCATAAGTAGTAAGG + Intergenic
1002663347 5:180805453-180805475 CAGTAAAAGTAAAAGCAGGCTGG + Intronic
1002942317 6:1728825-1728847 CAGAAAAAGAAAGAGGAGAAAGG - Intronic
1003883675 6:10501550-10501572 CACTAAAAGGGAAATTAGAAAGG - Intronic
1004264128 6:14134210-14134232 CAGAAATACCAAAAATAGAAGGG - Intronic
1005319337 6:24637155-24637177 CAGTCAAAGCAAAAGCAGAGTGG + Intronic
1006237841 6:32651204-32651226 CTGTAAAAGTAATAATAGAATGG + Intergenic
1006313968 6:33279558-33279580 CAGCCAAAGCCAAAGCAGAAGGG - Exonic
1006895897 6:37470647-37470669 CAGTGAAGACTAAAGTAGAAAGG + Intronic
1006958171 6:37896171-37896193 CTGTAAAAGAAAAAGAAAAAAGG - Intronic
1007889485 6:45272890-45272912 CAGGCAAAGCAAAAGCAGACTGG - Intronic
1008021263 6:46580481-46580503 CAATAAAAACAAAAATAGACAGG + Intronic
1008247658 6:49198304-49198326 AAGTAAAAGCACAATTAAAATGG + Intergenic
1008323319 6:50145262-50145284 AAGAAAAAGAAAAAGAAGAAAGG + Intergenic
1008730706 6:54479458-54479480 CAGTCAATGCAGAAGTAGATAGG + Intergenic
1008867920 6:56237117-56237139 CAGGAAAAGAAAAATTCGAAAGG + Intronic
1008995586 6:57654624-57654646 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009184113 6:60553402-60553424 CATTTAAAGCAAAAGAAGGAAGG - Intergenic
1009491956 6:64302500-64302522 CCATAAATGCAAAAGTTGAAAGG - Intronic
1009664592 6:66658930-66658952 CTGTTAAAGCAAAATTAAAATGG + Intergenic
1009778301 6:68234972-68234994 CAGTGAAAGCAAAGGTGCAAGGG + Intergenic
1009786434 6:68346088-68346110 CAAAAAAAGTAAAAGAAGAAAGG - Intergenic
1009891616 6:69691042-69691064 AAGAAAAAACAAAGGTAGAAAGG - Intronic
1010396063 6:75393477-75393499 CAGAAAAAGCATAATGAGAAAGG + Intronic
1010886106 6:81243193-81243215 CAGTTTGCGCAAAAGTAGAAAGG - Intergenic
1010900082 6:81416467-81416489 CATGAAAAGTAGAAGTAGAAAGG + Intergenic
1010907659 6:81511636-81511658 CAATCAAAGCAAAAGTGGAATGG - Intronic
1011170028 6:84495131-84495153 GAGTGGAAGAAAAAGTAGAATGG + Intergenic
1011869636 6:91876504-91876526 AGGTAAAAGCATAAGGAGAAGGG + Intergenic
1011888357 6:92126116-92126138 CAGCAAATGCACAAGGAGAAGGG - Intergenic
1012962128 6:105633191-105633213 CAACAAAAGCAAAAATAGACAGG + Intergenic
1013379084 6:109548910-109548932 CAGTCAAAGCAAAAGTGGACTGG + Intronic
1013627657 6:111953490-111953512 CAGAAAAAAAAAAAGTTGAAAGG - Intergenic
1013707838 6:112860008-112860030 CCATAAAAGCAAAAGCATAATGG + Intergenic
1013788520 6:113809915-113809937 CAGGAAGTGAAAAAGTAGAACGG - Intergenic
1014431796 6:121379750-121379772 CAACAAAAGCAAAAATAGACAGG - Intergenic
1014600638 6:123407505-123407527 CAGCAAAAGCAAGCATAGAAAGG - Intronic
1015024212 6:128513907-128513929 CAGTAAATTCAAGAGTAGAGAGG - Intronic
1015200030 6:130569001-130569023 CAGTAAGAGCAAAAGGCCAAGGG - Intergenic
1015328141 6:131948571-131948593 CATTAAAAACAAAAATAAAAAGG + Exonic
1015528568 6:134197527-134197549 CATAAAAAGCAAAAGTAGGCCGG + Intronic
1016218504 6:141634425-141634447 CAGTCAAAGCAAAAGCAGTTTGG - Intergenic
1016306388 6:142688830-142688852 CAACAAAAGCAAAAGTAGACTGG + Intergenic
1016450624 6:144178758-144178780 CATTCAAAGCAAAATTTGAAAGG - Intronic
1016684978 6:146870962-146870984 CAGTAAAAGCTCAAGCAGTAAGG + Intergenic
1016716023 6:147230026-147230048 CAATAAAACCAGAAATAGAAGGG - Intronic
1017313095 6:152997564-152997586 GAGTCAAAGCAAAAGCAGACTGG + Intronic
1017479678 6:154839607-154839629 AAGAAAAAGAAAAAGAAGAAAGG - Intronic
1017843003 6:158237355-158237377 CAGCAACAGAAAAAGAAGAAAGG - Intronic
1018240914 6:161773821-161773843 CAGAAAAAGAAGAAGAAGAAGGG + Intronic
1018289195 6:162273175-162273197 TTGTAAAAGGAAACGTAGAAAGG + Intronic
1018601169 6:165542916-165542938 CAGTAAAAGAACAAGTATATTGG - Intronic
1020413971 7:7924797-7924819 GAGGAAAAGGAAAAGTTGAAGGG + Intronic
1020478102 7:8623013-8623035 CAGAAAGAGCAAAAGCAGAGTGG + Intronic
1020490863 7:8782561-8782583 AATTAACAGCAAAAGTAAAAAGG - Intergenic
1021059991 7:16099457-16099479 CAGGAAAAACATAAGGAGAAGGG + Intronic
1021089605 7:16467733-16467755 CAGAAAAAGAAAAAGTAGTGAGG - Intronic
1021212683 7:17874559-17874581 AAGAAAAGGCAAAAGAAGAAAGG + Intronic
1021330859 7:19338053-19338075 CAGTAAGAGGAGCAGTAGAATGG - Intergenic
1022044687 7:26613563-26613585 CAGGAAAAGCAAAGGTACAGAGG + Intergenic
1022085138 7:27059870-27059892 CACAAAAAGTATAAGTAGAAGGG - Intergenic
1022481758 7:30748467-30748489 CAGAAAAAGCAAATGTACAGGGG - Intronic
1022513513 7:30959700-30959722 CTGTCAAAGCAAAAGCAGACCGG + Intronic
1022750289 7:33217932-33217954 CATTAAAAGCAAATGGCGAAAGG + Intronic
1022755879 7:33289045-33289067 CAGTAAAAGCAAAAATTGTTGGG - Intronic
1022758623 7:33322884-33322906 CAGCAAAAGCAGTACTAGAAGGG - Intronic
1023222906 7:37938608-37938630 CAGTTAAAGCAAAAGCAGGCTGG - Intronic
1023570169 7:41563653-41563675 CATTAAAATAAAAAGTAGGAAGG - Intergenic
1023800999 7:43834750-43834772 CAGGAAAAGGAAAAGGAAAAGGG - Intergenic
1024435383 7:49347235-49347257 CAATAATTTCAAAAGTAGAAAGG + Intergenic
1024830321 7:53446568-53446590 AATTAAAAGGAAAAGTAGAGGGG - Intergenic
1025791937 7:64696666-64696688 CATAAAAACCAAAAGTGGAAGGG - Intronic
1026397610 7:69972482-69972504 CAATAAAAGCAAGAATATAAAGG - Intronic
1026639790 7:72114227-72114249 AAGTAAAAATAAAAGTTGAAGGG + Intronic
1027516964 7:79154448-79154470 CAGTAAAAGCACAAATAAATTGG + Intronic
1027924470 7:84443819-84443841 CAGTCAAAGCAAAAGTAGACTGG - Intronic
1028108529 7:86909936-86909958 CAGTAAAAGAAATAGTGGCAGGG - Exonic
1028195941 7:87908133-87908155 CAGTAAATGTAGAAGTTGAAGGG - Exonic
1028266250 7:88729930-88729952 CAGTAAAAGCAGTAGTAAGAGGG - Intergenic
1028325166 7:89514942-89514964 CAGTCACAGCAAAAGTAGCCTGG + Intergenic
1028651548 7:93155792-93155814 TAGTAAAAGCAAGAAGAGAAAGG + Intergenic
1028779902 7:94724206-94724228 CAGCAATTGCAAAAGCAGAAAGG - Intergenic
1028865076 7:95699808-95699830 CAGTAAAGGAAAAAATAAAATGG - Intergenic
1029038494 7:97548531-97548553 CGGTGAAAGCCCAAGTAGAAAGG - Intergenic
1029099390 7:98115787-98115809 CAAAAAAAGCAAAAAAAGAAAGG + Intronic
1029837082 7:103323597-103323619 AAGAAAAAGAAAAAGCAGAATGG - Exonic
1030054535 7:105571504-105571526 CAGTCAAAGCACAAGTTGACCGG + Intronic
1030954373 7:115833766-115833788 TAGTAAAAACAAAAATACAAAGG - Intergenic
1031022556 7:116643726-116643748 AATTAAAAACAAAAGTAAAAAGG - Intergenic
1031241743 7:119252973-119252995 AAGTAAAAGGAAAAATAAAAAGG - Intergenic
1031549111 7:123086201-123086223 CAGTATCAGAAAAAGGAGAATGG + Intergenic
1031587491 7:123550107-123550129 CAATAAAAGCAAAACAAAAAAGG - Intronic
1031769362 7:125823721-125823743 CAGTCAAAGCAAAAGTGGACTGG + Intergenic
1031942737 7:127806476-127806498 CAGAAAAACCAAAAGAAGAGAGG - Intronic
1032168524 7:129564805-129564827 CAGTAACAGTAAAAATAGAAAGG - Intergenic
1032488654 7:132307281-132307303 GAAAAAAAGCAAAAGCAGAATGG - Intronic
1032625688 7:133589381-133589403 CAGTAAAAGCAAAAATGGACAGG - Intronic
1032808915 7:135388703-135388725 CATTAAAAGCAAAATCATAAAGG + Intronic
1032840482 7:135709583-135709605 CATTAAATTAAAAAGTAGAAAGG - Intronic
1032911543 7:136437179-136437201 CAATAAAAGCAAAAGCTGCAAGG + Intergenic
1033214868 7:139485986-139486008 CAGTCACAGCAAAAGTGGACAGG + Intergenic
1033520332 7:142154063-142154085 CAGATCCAGCAAAAGTAGAACGG - Intronic
1033706381 7:143889645-143889667 CAGTCAAAGCAAAAGCAGATGGG + Intronic
1033839370 7:145355299-145355321 CAATAAAACCAAAAATAAAAAGG + Intergenic
1033896004 7:146071415-146071437 TAGTAAAAGCAAAACTAACATGG - Intergenic
1034039349 7:147860672-147860694 CAGTCATGGCAGAAGTAGAAGGG - Intronic
1034481791 7:151326994-151327016 CAGTCACAGCAAAAGCAGACTGG - Intergenic
1037527125 8:19736952-19736974 CATTAAAAATAAAAGCAGAAAGG + Intronic
1038342887 8:26702548-26702570 TAATAAAAACAAAAGTAGGAAGG - Intergenic
1039027500 8:33273513-33273535 TTGTAAAAGCAAAATGAGAAAGG + Intergenic
1039124833 8:34189753-34189775 CAGCAAAAGGAAAAGAAGAGGGG - Intergenic
1039193585 8:35004829-35004851 CAATAAAATCAAAAAAAGAATGG - Intergenic
1039200492 8:35086778-35086800 CACTAAAAGCAACAGAAAAAAGG - Intergenic
1039802529 8:40972191-40972213 CAGCCAAAGCAAAAGCAGACCGG + Intergenic
1041309393 8:56499247-56499269 CAGTCAAAGCAAAAGTGGATCGG - Intergenic
1041332757 8:56745707-56745729 TAGTAAAAGGAAAAATAAAATGG - Intergenic
1041417715 8:57630675-57630697 CAGTGAAACCAAGAGAAGAAAGG - Intergenic
1041507006 8:58610303-58610325 CAGTTAAAGCAGAATGAGAAGGG - Intronic
1041589668 8:59562868-59562890 CAGTCAAAGCAAAAACAGACTGG + Intergenic
1042098246 8:65243218-65243240 GAGGAAAAGTAAAAGGAGAAGGG - Intergenic
1042622999 8:70726667-70726689 CAGTCAAAGCAAGAGTGGATTGG + Intronic
1042807107 8:72782849-72782871 CAGAAAAAGAAAAAGAAAAAAGG - Intronic
1043089387 8:75878198-75878220 CAGTAAAACCAATAGTATTATGG + Intergenic
1043111905 8:76196091-76196113 TAGTAAAAGCAGAATTAGAGAGG + Intergenic
1043229597 8:77784942-77784964 CAGAAAAAGCAAAGGAATAAGGG + Intergenic
1043333731 8:79148604-79148626 CTATAACAGCAAATGTAGAAAGG - Intergenic
1043399970 8:79874901-79874923 CAGTAAAATTAAAAATTGAATGG + Intergenic
1044001407 8:86885810-86885832 AAGTAAACTCAAAAATAGAATGG - Intronic
1044330786 8:90917801-90917823 CAGTAAAAGAAAAAGTAGAATGG - Intronic
1044553799 8:93540395-93540417 CAGTAAAAGAAAAAGAAGACAGG + Intergenic
1045895487 8:107211027-107211049 CAGTCAAAGCAAAAGCAGACTGG + Intergenic
1046078430 8:109339773-109339795 CACTTAAAAAAAAAGTAGAAGGG + Intronic
1046305859 8:112366129-112366151 CAGTCAAAGCAAAAACAGACTGG + Intronic
1046680022 8:117158377-117158399 AAGAAAATGCAAAAGTAAAATGG - Intronic
1046952959 8:120035431-120035453 CAGTAAAAGCAAATTTTGTATGG + Intronic
1047307691 8:123666296-123666318 CAGTAAGAGAGAAAGTAAAACGG + Intergenic
1047626063 8:126657327-126657349 CAGTAAAAGGAAACAAAGAAGGG - Intergenic
1047973168 8:130103856-130103878 CAGTAAAAACAATACTAAAAAGG - Intronic
1048065613 8:130965193-130965215 CAACAAAAGCAAAAGTTGACAGG - Intronic
1048164787 8:132053038-132053060 CAGTACAAGCAAAGGCAGGATGG - Intronic
1048489076 8:134875274-134875296 CAGTCAAAGCAAAAGTGGAGGGG - Intergenic
1049026551 8:139994807-139994829 CAGTTAAAGCAAAAATCGTAAGG + Intronic
1050379317 9:5010120-5010142 CAGGAAGATCAAAAGTAGATAGG - Intronic
1050499208 9:6277260-6277282 GACTAAAAACTAAAGTAGAATGG + Intergenic
1050587678 9:7130008-7130030 CATTTAAAGCAATAGGAGAAGGG + Intergenic
1050898543 9:10914343-10914365 CAATAAAAACATAAGTAGCATGG + Intergenic
1051707671 9:19897926-19897948 CAGCAAAAGGAAAAGTGGGATGG - Intergenic
1051967086 9:22842548-22842570 AAATAGAAGGAAAAGTAGAAGGG - Intergenic
1052142708 9:25006662-25006684 AAACAAAAGCAGAAGTAGAAGGG - Intergenic
1052143471 9:25019407-25019429 TAGTAAAAGCAAATGTAAATTGG - Intergenic
1052175474 9:25457291-25457313 CAGTCAAAGCAAAAGTTAACTGG - Intergenic
1052486952 9:29113809-29113831 CAGTCAAAGCAAAAGTAAACTGG + Intergenic
1053170544 9:35877629-35877651 CAGGAAAAGCAACAGTCAAATGG - Intergenic
1055181304 9:73390000-73390022 CAGAAAAACAAGAAGTAGAAGGG - Intergenic
1055192900 9:73548151-73548173 CAGTACAAGACAAAATAGAAAGG - Intergenic
1055242462 9:74200016-74200038 CAGTGAAAGGAATAGTAGAGAGG - Intergenic
1055606742 9:77978143-77978165 CTGTAAAAGCAATAATGGAAGGG - Intronic
1055669337 9:78586042-78586064 CAGTAACTGAAAAAGTAAAAAGG + Intergenic
1056160566 9:83887533-83887555 CAGTAAAAGTAGAAGTTGATAGG - Intronic
1056419782 9:86412824-86412846 CAGTCAAAGCAAAAGACGATGGG + Intergenic
1056510818 9:87303652-87303674 CAGTCACAGCAAAAGAATAAAGG + Intergenic
1056696701 9:88862476-88862498 CAGAAAATGATAAAGTAGAATGG + Intergenic
1056879851 9:90380679-90380701 CAAAAAAAAAAAAAGTAGAAAGG + Intergenic
1056919311 9:90772209-90772231 CTGAAAAAGCCAAGGTAGAAGGG - Intergenic
1057223740 9:93273854-93273876 CAGTAAGAGAAAAAGTTGGAAGG + Intronic
1057624817 9:96667709-96667731 CAAATAAAGCAAAAGTAGCAGGG - Intergenic
1058925111 9:109655620-109655642 CACAGAAACCAAAAGTAGAATGG - Intronic
1058952210 9:109914483-109914505 CAGCACAAGTAAAAGTGGAAAGG - Intronic
1059652671 9:116330005-116330027 AAGCAAAAACAAAAGTAAAATGG - Intronic
1060559701 9:124532959-124532981 CAGTAACAGCAGAAGTAGTGAGG - Intronic
1060751435 9:126172251-126172273 CAAAAAAACCAAAAGAAGAAGGG - Intergenic
1061138732 9:128751643-128751665 CATTAAAAACAAAAGGAGTAGGG - Intronic
1061184647 9:129045460-129045482 AAAAAAAAGCAAAAGTAGACCGG + Intronic
1062301160 9:135871095-135871117 GATTAAATGCAAAAGTAGATAGG + Intronic
1062456207 9:136640436-136640458 CCATAAAAGCAAGACTAGAAAGG - Intergenic
1062456725 9:136643445-136643467 CTGTAAATCCAAAGGTAGAAGGG + Intergenic
1186628697 X:11324295-11324317 CAGTCAAAGTAAAAGCAGACTGG + Intronic
1186848704 X:13557695-13557717 CAGTTAAAGCAAAAGTGGATGGG - Intergenic
1188151191 X:26678005-26678027 CAGTTAGAGCAAAAGCAGACTGG - Intergenic
1188153840 X:26716133-26716155 CAGTCAGAGCAAAAGCAGACTGG - Intergenic
1188266040 X:28076009-28076031 CAGTGAAAGCAAAAGGAGACAGG + Intergenic
1188554425 X:31395989-31396011 CAGTAATAGCTAAAGGACAAAGG - Intronic
1188650326 X:32624212-32624234 AAGTAAAAGCAAAAGGTGAATGG + Intronic
1188740692 X:33776270-33776292 CAGCAAAAGCAGTAGTAAAAGGG - Intergenic
1188891587 X:35617843-35617865 CCATAAAAGCAAGAGGAGAAAGG + Intergenic
1189084584 X:38008438-38008460 CAGTAAAATCAAAAGTCCATGGG - Intronic
1189457904 X:41210955-41210977 AAGGAAAAGAAAAAGGAGAAAGG - Intronic
1189637016 X:43022189-43022211 CAATCAAAGCAAAAGCAGAATGG - Intergenic
1189660333 X:43290198-43290220 TAGTCAAAGCAAAAGTGCAAGGG - Intergenic
1189684207 X:43546855-43546877 CAGTCAAAGCAAAAGCAAACTGG - Intergenic
1190223485 X:48528308-48528330 AAGTAAAACCAGAAGTAGAGAGG - Exonic
1190572640 X:51799806-51799828 TAGTCAAAGGAAAAGTAGACTGG - Intergenic
1191118800 X:56881038-56881060 CAGTAAAAGAAATACTAAAAGGG - Intergenic
1191600242 X:62995862-62995884 CAGTTGAAGAGAAAGTAGAAAGG - Intergenic
1192138149 X:68625406-68625428 CAAAAAAAGCAAAAATAGACAGG - Intergenic
1193080750 X:77403891-77403913 AAGAGAGAGCAAAAGTAGAAGGG + Intergenic
1193226319 X:78988483-78988505 GAGTAAAACAAAAAGGAGAAAGG - Intergenic
1193787370 X:85775545-85775567 CATAAAGACCAAAAGTAGAATGG - Intergenic
1194220764 X:91187447-91187469 CAGTCAAAGCAAAAGTGGACAGG + Intergenic
1195333417 X:103825831-103825853 AAATAAAAGGAAAAGTAGGAGGG + Intronic
1195632774 X:107076520-107076542 TAGTAAAACAGAAAGTAGAATGG + Intronic
1195874636 X:109526460-109526482 CAGAAAAGTCAAAAGTAAAAAGG + Intergenic
1195931274 X:110079407-110079429 CGGTCAAAGCAAAAGTGGACTGG - Intronic
1195960592 X:110382488-110382510 AACTAAAAGGAAAAATAGAAAGG + Intronic
1196210450 X:112990233-112990255 CAAAAAAAGAAAAAGAAGAAAGG - Intergenic
1196402752 X:115333186-115333208 CAGAGAAATGAAAAGTAGAATGG - Intergenic
1196507398 X:116463378-116463400 GAGTAAAAGCTAAAATAGCAAGG - Intergenic
1196638073 X:118027023-118027045 CAGTCAAAACAAAAGCAGACTGG + Intronic
1196658153 X:118241458-118241480 CATTAAAAGAGAGAGTAGAAAGG - Intergenic
1196835533 X:119810467-119810489 CAGTCAAAGCAAAAGTGGTCTGG + Intergenic
1196836521 X:119818939-119818961 CAGTCAAAGCAAAACTGGACTGG + Intergenic
1196969773 X:121096191-121096213 CATTAAAGTCAAAGGTAGAAAGG - Intergenic
1197323664 X:125065158-125065180 CAGTCAAAGCAAAAGCAGACAGG + Intergenic
1197419159 X:126216680-126216702 AAGAAAAAACAAAAGTAGCATGG - Intergenic
1197759343 X:130016566-130016588 CAGTAAAGGAAAAGGAAGAATGG - Intronic
1197779390 X:130144507-130144529 CAGCATAAGCAAAAGCACAAGGG - Intronic
1197834167 X:130677061-130677083 CAGCATGAGCAAAAGTACAAAGG - Intronic
1198716955 X:139567759-139567781 CAGAAAAAGAAAAAGAGGAAGGG + Intergenic
1198995225 X:142566767-142566789 AAGTAAAGGGAAAAGTAAAAGGG - Intergenic
1199040537 X:143110725-143110747 CAGTAAAGGGCAAACTAGAATGG + Intergenic
1199105583 X:143862870-143862892 CAGGAAAAGCAGAGGTAGAAGGG - Intergenic
1199920770 X:152400733-152400755 CTTTAAAAGCAAAAGAGGAAGGG + Intronic
1200694302 Y:6344819-6344841 AAGTAAAAGAAATAATAGAAAGG + Intergenic
1200768191 Y:7098911-7098933 AAGTGAAAGCATAAGTAGAGTGG + Intergenic
1200795876 Y:7340866-7340888 CAGTACCAGCAACAGTAGCAAGG + Intergenic
1201040975 Y:9829897-9829919 AAGTAAAAGAAATAATAGAAAGG - Intergenic
1201074076 Y:10173539-10173561 ATTCAAAAGCAAAAGTAGAAGGG + Intergenic
1201937559 Y:19424453-19424475 AAGTTTCAGCAAAAGTAGAATGG + Intergenic
1201947626 Y:19528851-19528873 CATTAAAGGCAAGAGGAGAATGG + Intergenic
1202143497 Y:21753518-21753540 AAGAAAAAGAAAAAGTAGATAGG - Intergenic