ID: 1074729861

View in Genome Browser
Species Human (GRCh38)
Location 10:116359553-116359575
Sequence AGGGTGCTACTGCATCTAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 139
Summary {0: 1, 1: 1, 2: 5, 3: 17, 4: 115}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074729861_1074729864 -6 Left 1074729861 10:116359553-116359575 CCCACTAGATGCAGTAGCACCCT 0: 1
1: 1
2: 5
3: 17
4: 115
Right 1074729864 10:116359570-116359592 CACCCTGCATTCACCGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074729861 Original CRISPR AGGGTGCTACTGCATCTAGT GGG (reversed) Intronic
901408720 1:9067745-9067767 AGGGAGCTACTGCGTCTAGAAGG + Intronic
909198058 1:72651453-72651475 AAGGTGCAAATGCATGTAGTGGG - Intergenic
910033182 1:82756993-82757015 AGAGTGCTATGGCATCTAGACGG + Intergenic
912956990 1:114161342-114161364 CGTGTGCCACTGCATCCAGTAGG - Intergenic
914708053 1:150187688-150187710 GGAGTGCTACTGCATCAAGTGGG - Intergenic
915989026 1:160494448-160494470 AGGGTGATTCTGCCTGTAGTGGG + Intronic
921336545 1:214092771-214092793 TTGGTGGGACTGCATCTAGTTGG - Intergenic
922177865 1:223211134-223211156 GGGGTACTATTGCATCTTGTGGG - Intergenic
922331588 1:224581630-224581652 ACAGTGCTATTGCATATAGTTGG + Intronic
924186382 1:241495660-241495682 GGGGTGCTACTGGCTCTAATTGG - Intergenic
1063371250 10:5524387-5524409 AGAGTGACACTGCACCTAGTAGG + Exonic
1065629969 10:27669462-27669484 AGCATGCTACTGCATCTATCTGG - Intergenic
1068917382 10:62446892-62446914 AGGATGCTCCTGAATCAAGTGGG + Intronic
1070036438 10:72729832-72729854 GAAGTGCTACTGCACCTAGTGGG - Intronic
1070700765 10:78600179-78600201 AGGGAGCTTCTGAATGTAGTTGG - Intergenic
1072663335 10:97376689-97376711 TGGGTGCTCTGGCATCTAGTGGG - Intronic
1074402888 10:113156554-113156576 AGGCAGCTACTTCATCTGGTAGG + Intronic
1074729861 10:116359553-116359575 AGGGTGCTACTGCATCTAGTGGG - Intronic
1074824441 10:117204424-117204446 AAAGTGCTATTGCATCTGGTGGG - Intronic
1075638937 10:124050526-124050548 GGGGTGCTATGGCATCCAGTGGG - Intronic
1075653850 10:124148133-124148155 AGGATGCTATGGCATCTAGGAGG - Intergenic
1080948609 11:37003047-37003069 TGGGTGCCACTGCATTAAGTGGG + Intergenic
1082048575 11:47751470-47751492 GGAGTGCTACTGTATCTAGTGGG - Intronic
1087991551 11:104749610-104749632 ATAATGCTAATGCATCTAGTTGG - Intergenic
1088979903 11:114852880-114852902 AGGATGCTATTGCATCTAGTGGG - Intergenic
1090324918 11:125877095-125877117 AGAGTGCTGCTGCATCTAGTGGG + Intergenic
1090423513 11:126591615-126591637 AGGGTGGTAGTGCTTCTAGAAGG + Intronic
1090514814 11:127413053-127413075 AGGGTGCTATTGCACCGACTGGG + Intergenic
1095479039 12:42614538-42614560 AGGGTGCTACTTCATTTTGCTGG + Intergenic
1095906382 12:47382478-47382500 AGGATGCTACCCCATCTAGTGGG + Intergenic
1096117869 12:49066258-49066280 AGGGTGCCAGTGGTTCTAGTGGG - Exonic
1097015281 12:55981709-55981731 ATGGGTCTCCTGCATCTAGTGGG + Intronic
1099288644 12:80747243-80747265 GAGGTGTTACTGGATCTAGTGGG + Intergenic
1104582537 12:130021735-130021757 AGGTTGCTATGGCATCTAATGGG + Intergenic
1108696230 13:52904872-52904894 AGGAAACTACTGCAGCTAGTAGG - Intergenic
1111201780 13:84947813-84947835 AGCGTGCCACTGCCTCCAGTCGG + Intergenic
1112576510 13:100641225-100641247 ATGGTGCTAATGTTTCTAGTGGG - Intronic
1114683577 14:24507106-24507128 GGGGTGCTACTGCAACAAGAGGG + Intronic
1120876343 14:89379450-89379472 AGCGGTCTACTGCATCCAGTAGG - Intronic
1125718001 15:41830606-41830628 AGGCTGCAGCTGCATCTAGGAGG - Intronic
1126904325 15:53347960-53347982 AGAGTGCTATTGCATCAAGGTGG - Intergenic
1130366976 15:83249482-83249504 GGGGTGCTATGGCATTTAGTGGG + Intergenic
1130819931 15:87484366-87484388 AGGGTTCTACTGAATTTAATGGG - Intergenic
1130890919 15:88133225-88133247 AAGGGGCTGCTGCATCTCGTGGG + Intronic
1134083682 16:11341936-11341958 AGGGTGCCATGGCATCTCGTGGG + Intronic
1138676930 16:58658047-58658069 AGGGTGCAACTGTAGTTAGTGGG + Intergenic
1145053610 17:19683244-19683266 AAAGTGTTACAGCATCTAGTGGG + Intronic
1148221890 17:45868839-45868861 GAGGTGCTATAGCATCTAGTGGG + Intergenic
1149250707 17:54765842-54765864 AAAGTACTACTGCATCTAATGGG + Intergenic
1155007877 18:21745374-21745396 GGGGTGCTACTGCTGCTAATGGG - Intronic
1155241339 18:23866251-23866273 AGGGTGCCACTGCCTGAAGTCGG + Intronic
1157719254 18:49911107-49911129 AGGTAGCTGCTGCATCTAGCTGG - Intronic
1158571696 18:58601972-58601994 GGGGTGCTACTGCATCTGGCGGG - Intronic
1163109114 19:15147693-15147715 AGGGTGTTGCTGCATCTTGAAGG - Intergenic
1164776527 19:30857557-30857579 AGGGTGCTGCTGCCTCTGGGTGG + Intergenic
1168387124 19:55973546-55973568 AGGATGCTTCTGCATCCAGAGGG + Intronic
928729610 2:34216009-34216031 AGGGTGCTCCTGCATGAAGCTGG - Intergenic
935640073 2:105281881-105281903 GGTGTGCTATGGCATCTAGTAGG + Intronic
938702377 2:133891083-133891105 ACGATGCTACTACATCTAGTGGG + Intergenic
938714896 2:134010204-134010226 TGGCTGCTTCTGCATCTGGTGGG - Intergenic
941052050 2:160746230-160746252 TGGGAGCCACTGCATCTAGATGG - Intergenic
943016579 2:182517817-182517839 AAGGTGTTTCTGCATTTAGTGGG - Intronic
944225851 2:197348042-197348064 AGGGTGCTACTGAGTGTATTGGG - Intergenic
946121417 2:217518355-217518377 GGAGTGATACTGTATCTAGTGGG + Intronic
947722128 2:232376624-232376646 AGGGTGCTAAGGGATCTAGATGG - Intergenic
1172608890 20:36234674-36234696 GGGGTGCTACTAGCTCTAGTGGG + Intergenic
1173967823 20:47126813-47126835 GGCGTGCTACTGAATTTAGTGGG + Intronic
1174699668 20:52595228-52595250 AGGGTGCTACTGGCACTAGTGGG + Intergenic
1174728077 20:52885956-52885978 AGGGTACTACTGCATCAAGTTGG + Intergenic
1175600033 20:60265797-60265819 AGATTGCTACTGCATACAGTGGG + Intergenic
1175898115 20:62348881-62348903 AAGGTGCTCCTGTATCTAATGGG + Intronic
1176725630 21:10430197-10430219 GGTGTGCTACTATATCTAGTGGG - Intergenic
1179628819 21:42664376-42664398 ATGGTGCTGCTGCATTGAGTAGG + Intronic
1181977589 22:26741938-26741960 AGGGAACTACTGCGTGTAGTCGG - Intergenic
1182782252 22:32877537-32877559 GGAGTGCTGCTGCGTCTAGTGGG - Intronic
1182863532 22:33582135-33582157 GGGGTGCTACTGGATCCAGGGGG + Intronic
1185030564 22:48440852-48440874 AGGGGGCTCCCGCATCTAGTGGG - Intergenic
951109703 3:18787494-18787516 AGGGGTCTACTGCATCTCCTGGG - Intergenic
953013933 3:39054372-39054394 GAGATGCTACTACATCTAGTTGG - Intronic
955661227 3:61301497-61301519 AGAGTGCTGCTGAATTTAGTGGG - Intergenic
955730242 3:61977245-61977267 GGGGTGACACTGCCTCTAGTTGG - Intronic
956118397 3:65941520-65941542 AGAGTGCTACTGCATCTACAGGG - Intronic
956469422 3:69550700-69550722 TAGAGGCTACTGCATCTAGTAGG - Intergenic
956940534 3:74156061-74156083 AGTGTTCTACTGCATTTACTTGG - Intergenic
958263656 3:91411874-91411896 AAGATGCTACTGTAACTAGTAGG - Intergenic
959031203 3:101300768-101300790 AGATTGCCACTGCTTCTAGTTGG + Intronic
961310648 3:125997230-125997252 AGGGTCATACTGCCTCAAGTGGG + Intergenic
964449280 3:156795123-156795145 TGTGAGCTACTGCATCCAGTTGG - Intergenic
972587449 4:40450797-40450819 AGGGGGCTTTTGCATCTAGTGGG - Intronic
975566885 4:75766478-75766500 AGAGTGCTACTGCGTCTAGTGGG + Intronic
977564081 4:98563850-98563872 AGGGTGCACTGGCATCTAGTGGG + Intronic
982343583 4:154331656-154331678 ATGGTGCTGCTGCCTTTAGTGGG - Exonic
982981500 4:162142027-162142049 AAGGTGCTATTGTATCTAATGGG + Intronic
984189144 4:176583833-176583855 GGGGTGCTACTGAGTCCAGTGGG - Intergenic
990191767 5:53267657-53267679 AGGGTGCTTCTGCATGATGTGGG - Intergenic
993826421 5:92692817-92692839 AGGTTACTATTGCATATAGTAGG + Intergenic
996403325 5:123085825-123085847 TGGGTGCTCCTGCTTCTAGTAGG - Intergenic
1000382607 5:160642532-160642554 GGGGTGCTAATGCATCTTGTGGG + Intronic
1003617618 6:7669862-7669884 AGTGTGCTACGGCGTCTAGTGGG - Intergenic
1005302138 6:24481492-24481514 AGGGTGATTCTGCCTCTAGAAGG - Intronic
1007688079 6:43679220-43679242 GGAGTGCTACTGCATCTAGCAGG + Intronic
1008618246 6:53246781-53246803 AGGGTGCCACTGCATCAGATGGG - Intergenic
1008991775 6:57611098-57611120 AAGATGCTACTGTAACTAGTAGG + Intronic
1009180291 6:60509344-60509366 AAGATGCTACTGTAACTAGTAGG + Intergenic
1010166209 6:72917984-72918006 GGGGTGCTATTGCGTCTAGTGGG - Intronic
1010402151 6:75458219-75458241 AGGACGCTACTGCATCAGGTGGG + Intronic
1012374594 6:98546541-98546563 AGGGTTCTTGTACATCTAGTTGG + Intergenic
1023767020 7:43521279-43521301 GTGGTGCTACTGTACCTAGTGGG - Intronic
1024160598 7:46671141-46671163 AGGGTGTTAGTCCATTTAGTTGG - Intergenic
1025248226 7:57334039-57334061 GGCATGCTACTGCATCTAGATGG + Intergenic
1025625515 7:63217856-63217878 AGAGTGGTCCTGCAGCTAGTTGG + Intergenic
1028439998 7:90848815-90848837 AGGTTCCTATTCCATCTAGTGGG + Intronic
1028917676 7:96277607-96277629 AGGGTGCTACTGGCTCCAGCAGG + Intronic
1031210526 7:118820231-118820253 AGAGTGCTGCTGCCTCTAGAAGG + Intergenic
1031968211 7:128043526-128043548 ATTGTGCCACTGCATCTAGCTGG + Intronic
1033252699 7:139775054-139775076 GGGGTGCTGCTGCACCAAGTTGG - Intronic
1034002601 7:147432248-147432270 GGGGTGCTATGCCATCTAGTGGG - Intronic
1034937080 7:155207131-155207153 AGGGTGCTCCTGGATTTTGTTGG + Intergenic
1040070273 8:43181596-43181618 AGGGAGCCACTGCTTCCAGTAGG + Intronic
1044276669 8:90308526-90308548 AAGGTGATACTGCATCAGGTGGG - Intergenic
1044963521 8:97554187-97554209 AGGGTGCCATGGCATGTAGTGGG - Intergenic
1047952515 8:129946824-129946846 AGGGTGCCACTGCATCACATTGG + Intronic
1052407532 9:28081174-28081196 AAGGTGCTACTGCATCTAGTGGG - Intronic
1052500932 9:29289182-29289204 AGGGTGCTACTGAAACTACTGGG - Intergenic
1055489629 9:76791808-76791830 CAGGTGCTTCTGAATCTAGTCGG - Intronic
1186086219 X:5993466-5993488 AGGGTGTTAATGCACTTAGTTGG - Intronic
1186523768 X:10228951-10228973 GGGATGCTGCTGCATCTAGTGGG + Intronic
1186525276 X:10242597-10242619 GGGGTGCGATGGCATCTAGTGGG - Intergenic
1187042866 X:15615491-15615513 AGAGTACTACTGCATCTAGTTGG + Intergenic
1192967943 X:76199859-76199881 ATGGTGTTTCTGCATCTATTGGG + Intergenic
1193839586 X:86392953-86392975 GTGGTGCTATGGCATCTAGTGGG + Intronic
1194218901 X:91167499-91167521 AGGGTGCCAGAGCATCAAGTGGG - Intergenic
1195996610 X:110737944-110737966 AGGGTACTCTGGCATCTAGTGGG + Intronic
1197199839 X:123738740-123738762 AGTGTGGTACTGCATTTAGCTGG + Intergenic
1200555413 Y:4631255-4631277 AGGGTGCCAGAGCATCAAGTGGG - Intergenic
1201192428 Y:11456679-11456701 TGTATGCTACTGCATTTAGTGGG - Intergenic
1202248390 Y:22842940-22842962 AGGGAGCCACTTCATCTAGGCGG - Intergenic
1202401378 Y:24476688-24476710 AGGGAGCCACTTCATCTAGGCGG - Intergenic
1202469403 Y:25193398-25193420 AGGGAGCCACTTCATCTAGGCGG + Intergenic