ID: 1074738326

View in Genome Browser
Species Human (GRCh38)
Location 10:116459432-116459454
Sequence ATCCCTTTGCTGTGATATAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 135}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074738326 Original CRISPR ATCCCTTTGCTGTGATATAG AGG (reversed) Intronic
901355134 1:8639649-8639671 ATTTCTATGCTGTGAAATAGTGG + Intronic
901361775 1:8707440-8707462 CTTCCTTTGCTGTGACAGAGCGG - Intronic
905386671 1:37609194-37609216 ATTCCTTAGCTGTGAAAAAGAGG - Intergenic
908791822 1:67790428-67790450 ATCTCCCTGCTGTGGTATAGTGG - Intronic
908998001 1:70181946-70181968 AACACTTTGCTGTTATGTAGTGG - Intronic
914583248 1:149038734-149038756 ATCCCTTTACCATTATATAGTGG + Intronic
917290109 1:173463139-173463161 AACCCTTTACTGTTATGTAGTGG - Intergenic
923416521 1:233767885-233767907 ATCCCTTTACCATGATATAATGG + Intergenic
1064388372 10:14920034-14920056 ATCACTTTGATGTAATAAAGTGG + Intronic
1067244171 10:44522770-44522792 AGCCCTTTGCTGGGCTATAGGGG - Intergenic
1067267581 10:44759124-44759146 ATGCCATTGCTGTTATATTGAGG - Intergenic
1068791851 10:61037913-61037935 TTCCTTTTCCTGTGTTATAGTGG + Intergenic
1074738326 10:116459432-116459454 ATCCCTTTGCTGTGATATAGAGG - Intronic
1078166142 11:8887405-8887427 ATCCATTTTCTGTTATACAGTGG - Intronic
1079284217 11:19114921-19114943 ATACCTTTGCTGGGATAGACTGG - Intergenic
1079767415 11:24412350-24412372 ATTCTTTTCCTGTGATTTAGGGG - Intergenic
1080488219 11:32733175-32733197 ATCCCTTTGCCATTATATAATGG - Intronic
1080491103 11:32765020-32765042 ATCCCTTTGCCATTATATAATGG - Intronic
1081749915 11:45502374-45502396 TTGCCTTTTCTGTGATATGGAGG + Intergenic
1083008820 11:59374455-59374477 ATCCCTTTGCCATTATATAATGG - Intergenic
1083503226 11:63131009-63131031 ATCCCTTTACCATTATATAGTGG + Intronic
1088691125 11:112329342-112329364 ATCCCTTTACTATTATGTAGTGG + Intergenic
1095918581 12:47505875-47505897 ACCCCTTTCCTGTGATATATAGG - Intergenic
1097148743 12:56960656-56960678 ATCCCTTTACTGTTATGTAATGG - Intergenic
1097321409 12:58230677-58230699 ATCCCTTTACCATTATATAGTGG + Intergenic
1097365496 12:58708060-58708082 ATCCCTTTACTGTTATGTAATGG + Intronic
1098536962 12:71603971-71603993 TTCCCTTTGTGGTGAAATAGAGG - Intergenic
1099885015 12:88518293-88518315 ATTCCTTTGCTGTGACCTATGGG + Intronic
1101182830 12:102238351-102238373 ATCCCTTTACTGTTATGTAATGG + Intergenic
1102202396 12:111066679-111066701 ATCCCCTTGCTCTGCTCTAGGGG + Intronic
1104175148 12:126324383-126324405 ATCCCTTTACCATTATATAGTGG + Intergenic
1106593563 13:31118290-31118312 CTCCCTGTGCTGTGATGTGGTGG + Intergenic
1109866899 13:68276364-68276386 ATTCCTTGGCTGGGATATAAAGG + Intergenic
1110486065 13:76044186-76044208 TTCTGTTTGCTGTGATATAAAGG + Intergenic
1110994482 13:82088343-82088365 ATCACTTTTCAGTAATATAGTGG + Intergenic
1112923103 13:104639982-104640004 ACCACTTTTCTGTTATATAGAGG - Intergenic
1113276701 13:108738872-108738894 ATCCCTTTACTGTTATGTAATGG + Intronic
1113383550 13:109826780-109826802 ATCCCTTTACTATTATGTAGTGG + Intergenic
1114029985 14:18569647-18569669 ATCCCTTTACTATTATATAATGG - Intergenic
1115825076 14:37262129-37262151 TTCCCTTTTCTGTGGAATAGAGG - Intronic
1116165341 14:41328098-41328120 ATCCCTTTACCATTATATAGTGG + Intergenic
1116202096 14:41810478-41810500 ATACCTTGGCTGTCATATTGAGG - Intronic
1117117897 14:52535265-52535287 ATCCCTTTCCTGGGACAGAGGGG - Intronic
1119174282 14:72557756-72557778 ATCCCTTTGGTGTGACACACAGG - Intronic
1120748120 14:88170699-88170721 ATCCCTTTACTTTGATATTATGG - Intergenic
1121453056 14:94021687-94021709 ATCACTTTGCTGTGCTGTATTGG + Intergenic
1122728102 14:103773488-103773510 ATCCCTTTACTGTCAATTAGTGG - Intronic
1123027356 14:105432993-105433015 AACCCCGTGCTGTAATATAGGGG + Intronic
1124385329 15:29203755-29203777 TTCCCTTTGCTGTGATCAACTGG + Intronic
1125139592 15:36389030-36389052 ATCACTTTGCTATGCTACAGTGG + Intergenic
1128338696 15:66804846-66804868 TTTCCTTTTCTGTAATATAGAGG + Intergenic
1129549462 15:76432076-76432098 ATGCCTTAGCTGTGATGAAGCGG - Intronic
1132997474 16:2830640-2830662 ATCCCCATGCGGTGATATGGGGG - Intronic
1134089287 16:11382891-11382913 ATCCATTTACAGTGATATAAAGG + Intronic
1141971827 16:87489723-87489745 ATCCCTTTGATGAGATGAAGGGG - Intronic
1142349610 16:89574193-89574215 AGCCCTTGGCTGTCACATAGCGG - Intergenic
1144448799 17:15357052-15357074 ATCCCTTTACTGTTATGTAATGG - Intergenic
1150816702 17:68397523-68397545 ATGACTTTGCTTTGATAGAGAGG - Intronic
1153401515 18:4688259-4688281 TTCCCTTCCCTGTGTTATAGTGG - Intergenic
1157968568 18:52238628-52238650 ATCCGTTTGTTGTTATCTAGTGG + Intergenic
926383152 2:12311391-12311413 ATTCCATTGCTCTGAAATAGAGG - Intergenic
928649882 2:33392782-33392804 ATCATTTTGCTGTGATACATGGG + Intronic
929217581 2:39431928-39431950 ATCACTATGCTGTGCTACAGAGG + Intronic
929926868 2:46220009-46220031 ATCCCTTTACCATTATATAGTGG - Intergenic
930467440 2:51772781-51772803 ATCCCTTTACCATGATGTAGTGG + Intergenic
930631518 2:53759306-53759328 TTCCTTTTCCTGTGTTATAGTGG - Intronic
932282265 2:70503789-70503811 ATCCATTTGCTCTGACCTAGAGG + Intronic
932626286 2:73298979-73299001 TTTCCTTTTCCGTGATATAGAGG + Intergenic
934854015 2:97717969-97717991 ATCTCTGTGCTGTGATCCAGGGG + Intronic
934997675 2:98980256-98980278 ATCCCTTTACCGTTATATAATGG - Intergenic
935748661 2:106211566-106211588 TTCCTTTTCCTGTGTTATAGTGG - Intergenic
936649644 2:114411713-114411735 ATCCCTTTACCATTATATAGTGG + Intergenic
944030100 2:195225043-195225065 ATCCCTTTACCGTTATATAATGG - Intergenic
945368184 2:208982685-208982707 ATAGCTTTGCTGTGAAATACAGG + Intergenic
947959199 2:234220944-234220966 CTCCCTTTGCAGTTATAGAGAGG + Intergenic
948015507 2:234687228-234687250 AAGACTTTGCTTTGATATAGCGG + Intergenic
1179816213 21:43907999-43908021 ATCCCTTTGCTCTGCTATTACGG - Intronic
1179843186 21:44090822-44090844 TTCCCTTTGCTGTGATTTGAAGG - Intronic
1180454102 22:15496697-15496719 ATCCCTTTACTATTATATAATGG - Intergenic
1181326676 22:22055004-22055026 ATCCCTTTACTATTATGTAGTGG + Intergenic
949745849 3:7291401-7291423 ATCCTTTTGCTGTGGCCTAGTGG + Intronic
957442487 3:80267738-80267760 ATCCCTTCACTGTGGTATATAGG - Intergenic
958404055 3:93729796-93729818 ATCCCTTTACTATTATATAATGG + Intergenic
962141324 3:132793692-132793714 ATCCATTTGCATTGCTATAGAGG + Intergenic
965036565 3:163446773-163446795 ATCCCTTTACTTTGAACTAGTGG - Intergenic
967896823 3:194402064-194402086 GTCCCTTGGCAGTGATACAGCGG + Intergenic
971307690 4:25497986-25498008 ATGCCTTTGTTTTCATATAGGGG - Intergenic
972291747 4:37696044-37696066 ATTACTTTATTGTGATATAGAGG + Intergenic
973159688 4:47000566-47000588 ATCCCATTGCAGTTAGATAGTGG + Intronic
973655695 4:53045108-53045130 ACCTCTTTGCTGTGATGTATTGG - Intronic
977194984 4:94047162-94047184 ATCCCTTTACCATTATATAGTGG - Intergenic
977466858 4:97393199-97393221 ATTCCCTTGCTGTGACATAATGG - Intronic
979555740 4:122044978-122045000 ATCCTTTTATTGTGATATACTGG - Intergenic
979757839 4:124363630-124363652 ATCCCTTTACTGTTATGTAATGG - Intergenic
979766754 4:124472727-124472749 CTCCCTTTGTTTTAATATAGAGG + Intergenic
982601978 4:157463233-157463255 ATCCCATTACTGGGATATACAGG + Intergenic
984638468 4:182140058-182140080 ATCCCTTGGCTGTTAGATTGAGG - Intergenic
987307003 5:16646940-16646962 ATCCCTTTGCCATTATATAATGG + Intergenic
987739879 5:21893908-21893930 ATACCTTTTCTGTGATGTAAAGG - Intronic
988887260 5:35571956-35571978 ATCCCTTTACTGTTATGTAATGG + Intergenic
992027816 5:72688152-72688174 ATCAGTTTGCTGTGATAGACTGG + Intergenic
994308558 5:98238418-98238440 ATCCCTTTACAATTATATAGTGG + Intergenic
994972969 5:106766309-106766331 ATCCCTTTGTTGAGCTTTAGAGG - Intergenic
997278797 5:132623986-132624008 ATCCATTTACTGTGAAATATTGG + Intronic
1001877181 5:175211668-175211690 AACCTTTTGCTTTGAAATAGGGG - Intergenic
1006089478 6:31620146-31620168 ATCCCTTTGCCGTGAGTTTGAGG - Intergenic
1006338782 6:33434471-33434493 ATCCCTTAGGTGTGAGATGGTGG + Intronic
1006938453 6:37735047-37735069 ATCCCTGTTCTCTAATATAGAGG - Intergenic
1013659626 6:112281700-112281722 AAACCTTTGCAGTGATGTAGTGG + Intergenic
1013678856 6:112500080-112500102 ATCCTTTTCCTCTGAAATAGAGG - Intergenic
1013941207 6:115665293-115665315 ATGCATTTGCTGAGAAATAGAGG - Intergenic
1014459323 6:121676774-121676796 AGCCCATTGCTGTGATGGAGGGG + Intergenic
1016174182 6:141057895-141057917 ATGCCTGTGCTGGGATATTGAGG - Intergenic
1018535634 6:164816057-164816079 TTCTCTTTGCTGTGTGATAGTGG + Intergenic
1018915807 6:168131704-168131726 ACGCCTTTGCTGTGAAATGGTGG - Intergenic
1021201954 7:17737083-17737105 ATCCCTTTACTGTTATGTAATGG - Intergenic
1021802542 7:24321788-24321810 ATCCATTTACTGTAATTTAGTGG - Intergenic
1023367367 7:39477109-39477131 ATCCCTTGTCTGTGATTTGGAGG + Intronic
1023563248 7:41497538-41497560 ATCACTCTGCTGTGGTATAAAGG + Intergenic
1030836657 7:114295547-114295569 ATCCCTTGGATATCATATAGGGG - Intronic
1031949052 7:127872976-127872998 ATCTCTTTGCTGGAATATAGTGG + Intronic
1032725810 7:134589301-134589323 TTCCTTTTCCTGTGTTATAGTGG - Intergenic
1033921260 7:146395241-146395263 ATTCCTTAGCTGTTAAATAGAGG - Intronic
1037791706 8:21949640-21949662 ATGCCTTTGTTGTTATATGGGGG - Intronic
1040827384 8:51638607-51638629 ATCCCTTTACTGTTATGTAATGG - Intronic
1046879715 8:119294429-119294451 ATCCCTTTACTGTTATGTAATGG - Intergenic
1047931770 8:129735062-129735084 ATCCCTTTACTGTTATGTAATGG - Intergenic
1048682405 8:136858103-136858125 ATCCCTTTACTGTTATGTAATGG + Intergenic
1052086980 9:24280061-24280083 ATCCCTTTACTATTATGTAGTGG + Intergenic
1052790481 9:32870842-32870864 ATACCTTTGCTGTGAAATTATGG + Intergenic
1057054013 9:91948338-91948360 ATCCCTTTGCTGGGGGAGAGGGG - Intronic
1059241663 9:112811261-112811283 ATCCCTTTGTTGGGAGATGGGGG + Intronic
1186250703 X:7662686-7662708 ATTCCTTTGCTGTTATTTGGTGG + Intergenic
1188025705 X:25207078-25207100 AAGCCTTTGCTGTCATTTAGAGG + Intergenic
1188230603 X:27658548-27658570 ATGCTTTTGGTGTGAGATAGGGG - Intronic
1188871534 X:35379379-35379401 ATCTCTTTTCTTTGATTTAGTGG + Intergenic
1189895852 X:45655729-45655751 AACCCTTTACTGTTATGTAGTGG + Intergenic
1197615158 X:128682455-128682477 CTCCCTTTGCTGTGTTATAAAGG - Intergenic
1198434049 X:136598045-136598067 ACATCTTTGCTGTGATATAGAGG + Intergenic
1199594478 X:149495797-149495819 ATTCCTTTGCCATGATTTAGGGG - Intronic
1201619865 Y:15944710-15944732 ATCCCTTTGCTATTATGTAATGG + Intergenic