ID: 1074740214

View in Genome Browser
Species Human (GRCh38)
Location 10:116479236-116479258
Sequence CAGTGGTACCACAGAGAAGA CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074740212_1074740214 -5 Left 1074740212 10:116479218-116479240 CCTGAAGTGCTGTTGGGACAGTG No data
Right 1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG No data
1074740210_1074740214 1 Left 1074740210 10:116479212-116479234 CCAGCACCTGAAGTGCTGTTGGG No data
Right 1074740214 10:116479236-116479258 CAGTGGTACCACAGAGAAGACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074740214 Original CRISPR CAGTGGTACCACAGAGAAGA CGG Intergenic
No off target data available for this crispr