ID: 1074744435

View in Genome Browser
Species Human (GRCh38)
Location 10:116517580-116517602
Sequence CAGTGCCATGGTAATACAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074744435_1074744438 23 Left 1074744435 10:116517580-116517602 CCGACTGTATTACCATGGCACTG No data
Right 1074744438 10:116517626-116517648 AAAAATATCACCGTTAGGCCTGG No data
1074744435_1074744437 18 Left 1074744435 10:116517580-116517602 CCGACTGTATTACCATGGCACTG No data
Right 1074744437 10:116517621-116517643 TACTTAAAAATATCACCGTTAGG No data
1074744435_1074744439 28 Left 1074744435 10:116517580-116517602 CCGACTGTATTACCATGGCACTG No data
Right 1074744439 10:116517631-116517653 TATCACCGTTAGGCCTGGCGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074744435 Original CRISPR CAGTGCCATGGTAATACAGT CGG (reversed) Intergenic
No off target data available for this crispr