ID: 1074751270

View in Genome Browser
Species Human (GRCh38)
Location 10:116589611-116589633
Sequence ACTTCCAGGCATCCCCAGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074751270_1074751276 -9 Left 1074751270 10:116589611-116589633 CCATCCTGGGGATGCCTGGAAGT No data
Right 1074751276 10:116589625-116589647 CCTGGAAGTAGGGAGGAAACAGG No data
1074751270_1074751280 7 Left 1074751270 10:116589611-116589633 CCATCCTGGGGATGCCTGGAAGT No data
Right 1074751280 10:116589641-116589663 AAACAGGTCAAGGGCCAAGAGGG No data
1074751270_1074751278 -2 Left 1074751270 10:116589611-116589633 CCATCCTGGGGATGCCTGGAAGT No data
Right 1074751278 10:116589632-116589654 GTAGGGAGGAAACAGGTCAAGGG No data
1074751270_1074751279 6 Left 1074751270 10:116589611-116589633 CCATCCTGGGGATGCCTGGAAGT No data
Right 1074751279 10:116589640-116589662 GAAACAGGTCAAGGGCCAAGAGG No data
1074751270_1074751277 -3 Left 1074751270 10:116589611-116589633 CCATCCTGGGGATGCCTGGAAGT No data
Right 1074751277 10:116589631-116589653 AGTAGGGAGGAAACAGGTCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074751270 Original CRISPR ACTTCCAGGCATCCCCAGGA TGG (reversed) Intergenic
No off target data available for this crispr