ID: 1074752134

View in Genome Browser
Species Human (GRCh38)
Location 10:116596694-116596716
Sequence TGCCCTTGATTTCAAAGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 229
Summary {0: 1, 1: 1, 2: 1, 3: 17, 4: 209}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074752134 Original CRISPR TGCCCTTGATTTCAAAGAGA AGG (reversed) Intronic
902307904 1:15556759-15556781 TGTTCTTGATTTCAAAGAGAGGG + Intronic
902327084 1:15708187-15708209 TTCTCATGATTTAAAAGAGAGGG + Intronic
904242179 1:29154483-29154505 GGCCTCTGATTTCTAAGAGAAGG + Intronic
905600921 1:39250161-39250183 TGCCCTTGCACTCAATGAGATGG - Intronic
905955085 1:41986114-41986136 TTCCCTTGATTTTAAAGATGAGG - Intronic
908141166 1:61186822-61186844 TCACCTTGATTTTACAGAGAAGG + Intronic
910921740 1:92355914-92355936 TGCTCTTCATATCAAAGATATGG + Intronic
911680201 1:100706580-100706602 TGCCCTTGATTTCAATGCAGAGG - Intergenic
917591180 1:176478739-176478761 TGCTCTTGAGTTCAAAGATAAGG + Intronic
921347432 1:214201198-214201220 TGCCCTTGATTTTGCAGATAGGG - Intergenic
921451845 1:215317821-215317843 TCCCATTGATTTTAAAAAGAAGG - Intergenic
921824873 1:219661156-219661178 TGTCCTACATTTAAAAGAGAAGG + Intergenic
923734716 1:236594546-236594568 AGCCCTTGCTTTCAAAGACTGGG + Intronic
1063320372 10:5046389-5046411 TGCCCTTGGTTTCCAACTGAGGG - Intronic
1063507847 10:6617812-6617834 TGCACTTGTGTTTAAAGAGAGGG - Intergenic
1065490820 10:26279975-26279997 TGTCCTGGAGCTCAAAGAGAGGG - Intronic
1065522662 10:26587452-26587474 TGCCTTTAATTTAAAAGATAGGG + Intergenic
1065908667 10:30282213-30282235 TTCCTCTGATTTCAAAGAGAAGG - Intergenic
1069735886 10:70653970-70653992 TGACCTTGAGTCCTAAGAGAAGG + Intergenic
1071896983 10:90078241-90078263 TTCCTTTGATTTCAAAGGGATGG + Intergenic
1073447146 10:103588520-103588542 AGCCCCTGACTTCAAAGAGCTGG - Intronic
1074752134 10:116596694-116596716 TGCCCTTGATTTCAAAGAGAAGG - Intronic
1075502809 10:122992841-122992863 TGCCCATAATTTCCAAGAAAAGG - Exonic
1080936344 11:36868018-36868040 TGCCCTTTATTTTGAAGGGAGGG - Intergenic
1081103736 11:39037897-39037919 GTCTCTTAATTTCAAAGAGATGG - Intergenic
1081615417 11:44587842-44587864 TGCCCCTGAGTCCGAAGAGACGG - Intronic
1082096723 11:48136984-48137006 GGCCCTTGATTTTAAAAAAAAGG - Exonic
1082950448 11:58809330-58809352 TTTCCTTTTTTTCAAAGAGAAGG - Intergenic
1084214645 11:67640750-67640772 TGGCCTTGATTCCTAAGAGGGGG + Intergenic
1084350100 11:68590953-68590975 GACACTTGACTTCAAAGAGAAGG + Intronic
1085764671 11:79272491-79272513 TGCCCTGGATTTCAGAGACTTGG - Intronic
1086517420 11:87628818-87628840 TGCCAGTGATTTGAAAGAGGTGG + Intergenic
1087398275 11:97631609-97631631 TGCCCTTGATTCCTAGGGGAGGG + Intergenic
1089173712 11:116533700-116533722 TCGCCTTCCTTTCAAAGAGAGGG + Intergenic
1092121829 12:6049820-6049842 TGCCCTTCATTTCCATGATATGG + Intronic
1093100278 12:15020008-15020030 TCTCCTTGAATTTAAAGAGAGGG + Intergenic
1093565791 12:20601821-20601843 AGCACTTGTTTTAAAAGAGATGG + Intronic
1093663812 12:21788499-21788521 TGGCCTAGATATCAAAGAGCTGG + Intergenic
1095317224 12:40779786-40779808 TGCCATTGATATCAAAGTGCAGG + Intronic
1098013586 12:66080612-66080634 AGCCCTTGATATGAAAGTGATGG + Intergenic
1098161929 12:67654053-67654075 TGCCCTTGTCTGCAAAAAGAAGG - Intronic
1098570297 12:71980680-71980702 TGGCCTTGTTTACAAATAGAAGG + Intronic
1099024014 12:77443129-77443151 TGCCCTTTGCTTCAGAGAGAGGG + Intergenic
1099102648 12:78461081-78461103 TTTCCTGGATTTCAAAAAGAAGG + Intergenic
1100351558 12:93788602-93788624 TGTTCTTGATTTTAAAGGGAGGG + Intronic
1101144461 12:101828264-101828286 TGGCCTCCATTTCAAAGATAAGG + Intronic
1104483125 12:129126034-129126056 TGCCCCTTATCTCAAAAAGAGGG - Intronic
1108539882 13:51431251-51431273 TACCTTTGATTTCAAATACAAGG - Intronic
1108699378 13:52930763-52930785 TTCCTTGGATTTCACAGAGAGGG + Intergenic
1108883231 13:55147214-55147236 TTCACTTGAGATCAAAGAGATGG - Intergenic
1109045909 13:57410086-57410108 TTCCCTTGATTTCCAAGAAGGGG - Intergenic
1110787450 13:79546654-79546676 TCACCCTGATGTCAAAGAGAAGG - Intronic
1110895693 13:80749535-80749557 TGCCCAAGAGTTCAAGGAGAAGG + Intergenic
1112018218 13:95349061-95349083 TGCCCTTGTTTTCAAATTCAGGG - Intergenic
1112803036 13:103133225-103133247 AGCCCTTGACTTCAAACAGTTGG + Intergenic
1113166366 13:107447987-107448009 TGCCCTGTATTTGAAAGAGCAGG - Intronic
1115603362 14:34976850-34976872 TGACCTAGATTTCAAAGTGTAGG - Intergenic
1116609631 14:47051217-47051239 TGCCTTTCATTTTATAGAGAAGG - Intronic
1118014246 14:61642218-61642240 TGGCCTGGCTTTCAAAGAAATGG + Intronic
1118076899 14:62309377-62309399 TGTCCTTGATTACAAAAAAATGG + Intergenic
1118973063 14:70653712-70653734 TGCTTTTCATTTCAAAGACAGGG - Intronic
1118992240 14:70808296-70808318 GGCATTTGCTTTCAAAGAGATGG - Intronic
1119695603 14:76710916-76710938 GGACCTTGATTTCAAAAAAAGGG + Intergenic
1123669080 15:22636694-22636716 TGCAGTTGATTTCTGAGAGACGG + Intergenic
1124126120 15:26939346-26939368 TGCCCCCGATTTCAAAGAACAGG + Intronic
1124723993 15:32138694-32138716 TGCCATGGATTGCAGAGAGAGGG - Intronic
1124773604 15:32564539-32564561 TGCAGTTGATTTCTGAGAGACGG - Intergenic
1128416930 15:67455311-67455333 AGCCCTTGATTTCAAATTCAAGG - Intronic
1129791247 15:78341798-78341820 TGCCCTTGAGGACTAAGAGAGGG - Intronic
1130080873 15:80732451-80732473 TCCACTTTATTTCATAGAGAAGG - Intronic
1131204666 15:90432993-90433015 TGGGCTTGATATCAAAGATATGG + Intronic
1132458963 16:40308-40330 TGCAATTGATTTCAATGACAGGG + Intergenic
1135755462 16:25093344-25093366 TGTCCTTGATTTCACAGTTAGGG - Intergenic
1139339845 16:66261236-66261258 TGTACTTGAGTCCAAAGAGAAGG + Intergenic
1139572894 16:67824405-67824427 TGCACTTGATTTTAAACAAAGGG - Intronic
1140837041 16:78804286-78804308 TGCCCTCAATTTCATTGAGATGG + Intronic
1143775572 17:9196579-9196601 TGCCCTGGATGGCAAAGACAAGG - Intronic
1145329376 17:21858361-21858383 TGCAATTGATTTGAAAGGGATGG + Intergenic
1149041654 17:52196973-52196995 CGCACTTGATTTCAAGAAGATGG - Intergenic
1150009758 17:61492908-61492930 TGCCCTCCACTTCACAGAGAAGG + Intergenic
1150962246 17:69926607-69926629 TGCCTTTGAAAGCAAAGAGAAGG - Intergenic
1152492237 17:80644248-80644270 TGCCTTTGATTCAAAAGATAAGG + Intronic
1152963043 18:91511-91533 TGCAATTGATTTCAATGACAGGG + Intergenic
1153794714 18:8610783-8610805 TGCCCTTTATTTTAAAGAACGGG - Intronic
1155509652 18:26563591-26563613 TTCTCTTGCTTTCACAGAGAGGG - Intronic
1157570787 18:48710644-48710666 TGCCCTGGGTTGCAAATAGAGGG + Intronic
1158568632 18:58577231-58577253 TGCCCCAAATTTCAAAGAGCTGG - Intronic
1159520342 18:69512194-69512216 TGCCCTTTTTTTGTAAGAGAAGG - Intronic
1159908546 18:74121144-74121166 TTCCTTTTCTTTCAAAGAGATGG - Intronic
1161361107 19:3850229-3850251 TGCCTGGGATTTCAAAGAGGAGG + Intronic
1162312763 19:9916905-9916927 TTCCCTTGACTTCAGAGACACGG + Intronic
1163320395 19:16571574-16571596 TGGCCTTGACTGCAAAGAGAGGG + Exonic
1165785430 19:38458983-38459005 TGCCCTTCATTTCAGAGCTACGG + Intronic
925675405 2:6356542-6356564 TGCCTTTGATTTGATGGAGAAGG + Intergenic
927243725 2:20940409-20940431 TGGCCTTGACTTTAAAGAGCAGG + Intergenic
927686876 2:25177375-25177397 TGCCCTTGAGGTCAAACCGAAGG - Intergenic
930256919 2:49103650-49103672 TGCCCTCAATTTAAAAGATAGGG - Intronic
931116772 2:59174046-59174068 TGCCCTTGGTTTCCAACTGAGGG + Intergenic
931133282 2:59364249-59364271 GGACTGTGATTTCAAAGAGAAGG - Intergenic
935884415 2:107600275-107600297 TACCCTAAATTTAAAAGAGATGG - Intergenic
936089273 2:109490535-109490557 TGCCCTTGCTGTCAGAGAGAGGG - Intronic
936715138 2:115178189-115178211 TGCCCTTGCCTACAAACAGAAGG + Intronic
936810445 2:116393786-116393808 TGACTTTGAGTTCAAAGATAAGG - Intergenic
938226828 2:129623965-129623987 TGCCCTTGATTCCAGACAAATGG - Intergenic
938952289 2:136266439-136266461 TGCCCTTCCTTTCAGAGAGGAGG + Intergenic
940845637 2:158638885-158638907 TGCCCTAGAATACAAAAAGATGG - Intronic
943002481 2:182345754-182345776 TGGCCTTGATGAGAAAGAGATGG - Intronic
943094070 2:183407492-183407514 TGCCCTTCAGTTCAACTAGATGG + Intergenic
943861429 2:192869068-192869090 AGCCCTTAATTTCAAATAGCTGG + Intergenic
943940545 2:193988885-193988907 TCTCCTTGATTTCAATGAGTGGG + Intergenic
945619185 2:212111958-212111980 TGCCATGAATTTCAAAGAGTTGG + Intronic
948404516 2:237707024-237707046 ACCCCTTGATTTGAAAGACATGG + Intronic
1169128568 20:3149624-3149646 TTGCCTTGATATCAAAGAGATGG - Intronic
1169567570 20:6872177-6872199 TACCCTTGATTTCAAGGGGACGG - Intergenic
1170043119 20:12059099-12059121 TGCCCTTGATAGGACAGAGATGG - Intergenic
1172164832 20:32892764-32892786 TGCCCTTGCTTCCAAGGAGGAGG + Intronic
1172517382 20:35544394-35544416 TGTTCTTTATTTCAGAGAGAGGG + Intronic
1177346487 21:19879272-19879294 TGCCCTTGACTGAAAAGAAAAGG - Intergenic
1179346075 21:40558692-40558714 TACACTTATTTTCAAAGAGATGG + Intronic
1181659957 22:24339096-24339118 TGCAGTTGAATTCACAGAGAAGG + Intronic
1181682803 22:24507465-24507487 CCCCCTTTATTTCACAGAGAAGG - Intronic
1182018877 22:27064192-27064214 TACCCTTGGTTTCACAGAAAGGG + Intergenic
1185180241 22:49355746-49355768 TGGCCTAGATTTCAATGAGGCGG - Intergenic
950215840 3:11158190-11158212 TGCCCTTGATGATAAATAGATGG + Intronic
951268812 3:20601500-20601522 TGCCCTTGTTTTCACAGGGTGGG + Intergenic
951502458 3:23404101-23404123 TGACATTGCTTTCTAAGAGAAGG + Intronic
951857990 3:27219174-27219196 TTGGCTTCATTTCAAAGAGATGG - Intronic
953655686 3:44851805-44851827 TGCCCTTTACAACAAAGAGATGG + Exonic
957019222 3:75105958-75105980 TGGAATTGATTACAAAGAGATGG + Intergenic
957589510 3:82177484-82177506 TGCCCTTGCTTTTGAAAAGAAGG + Intergenic
959550082 3:107644717-107644739 TGCCCTTGTTTTAAAAAATATGG + Intronic
959929397 3:111962625-111962647 TGCTTTTGATTTAAAAAAGAGGG + Intronic
960073777 3:113460214-113460236 TGCTCTAGATTTAGAAGAGATGG - Intronic
963340842 3:144031058-144031080 TGTCCTTATTTTTAAAGAGATGG - Intronic
966746306 3:183280539-183280561 TACCCTTGCTTTAAAAGAGTTGG - Intronic
967482857 3:189994339-189994361 AACCCTTATTTTCAAAGAGAAGG + Intronic
967641113 3:191864123-191864145 TGCCCTCAACTTCAAACAGAAGG - Intergenic
969054483 4:4393094-4393116 TGGCCTTGATTTCAAGGTCATGG + Intronic
969487609 4:7481029-7481051 CTCTCTTGATTTCAAAGAAAAGG - Intronic
969632215 4:8345403-8345425 TCACCCTGATTTCAAACAGAGGG + Intergenic
970377172 4:15470535-15470557 TTCCCTTCATTGCAAAGAGGTGG + Intronic
970678609 4:18481521-18481543 TGCCTTTATTTTCAAAGAAATGG + Intergenic
970865435 4:20753270-20753292 TATCCTCGATTTCTAAGAGATGG - Intronic
971314949 4:25560015-25560037 TTCCTTTCATTTCAAGGAGATGG + Intergenic
972580274 4:40389144-40389166 TGGCTTTGATATCAAAGAGCAGG + Intergenic
973863669 4:55090576-55090598 TTCCCCTGATTTCAAAGTGCTGG + Intronic
976618354 4:87101208-87101230 TGCCCGTGCATTCTAAGAGATGG - Intronic
976743625 4:88382017-88382039 TGCCCTTCATTTCCAAATGAGGG - Intronic
978213802 4:106172620-106172642 AGCCCTTCATTTCAAAAAGAGGG - Intronic
983246473 4:165293334-165293356 TTCCCTTGATTTCACAAATATGG - Intronic
984642682 4:182186436-182186458 TGTCTTTGAATTCAGAGAGAAGG + Intronic
985126297 4:186698193-186698215 TGTCCTTGAGTTCATGGAGACGG + Intronic
985383720 4:189422983-189423005 TGCCCTAGAATTTAAAGAAATGG - Intergenic
986157352 5:5189864-5189886 TGACCTGGATTTCAAATACATGG - Intronic
987206771 5:15635479-15635501 TGACCCTGATTTCAGGGAGAGGG + Intronic
988883164 5:35527260-35527282 TGCCATAGATTTTAGAGAGATGG + Intergenic
989112896 5:37924597-37924619 GGCCCTTGACCTCAAAGAAATGG - Intergenic
989115725 5:37950699-37950721 TGTCCTTGACTTCCCAGAGATGG + Intergenic
990220173 5:53579709-53579731 TCCCTTTTATTTTAAAGAGATGG - Intronic
990251199 5:53916874-53916896 TGCTCTGCATATCAAAGAGATGG + Intronic
990885843 5:60592681-60592703 TGCTCCTAATTTCAAAGAGGAGG - Intergenic
991412618 5:66359799-66359821 TGCTCGTGAGTTCAGAGAGAGGG + Intergenic
993692546 5:91020226-91020248 TGGCCTTGATCCCAAAGAGTAGG + Intronic
993838951 5:92852296-92852318 TGCCCTTTAATACAAAGAGGGGG - Intergenic
994470347 5:100196110-100196132 TGCACTTGTTTTCAAAGGGAAGG + Intergenic
999499051 5:152128550-152128572 TGCCTTTGATTTCAAAGAGATGG + Intergenic
999611359 5:153373341-153373363 TGCCATTGCTTTCAGAGAGGGGG - Intergenic
1000799818 5:165712097-165712119 AGCTTTTCATTTCAAAGAGAGGG - Intergenic
1002919903 6:1560736-1560758 TGCCCCTGATTTGAATGACATGG + Intergenic
1003403992 6:5813535-5813557 TGCACTTGATTTTACGGAGACGG + Intergenic
1004110158 6:12709811-12709833 AGCCCTTGATTTAAAAAAGCTGG - Intergenic
1004386423 6:15176927-15176949 TTCCCTTCATTTTACAGAGAAGG - Intergenic
1005317104 6:24613776-24613798 CAACCTTTATTTCAAAGAGATGG + Intronic
1005327591 6:24718539-24718561 TGCCTTTGTATTCAAGGAGAAGG - Exonic
1006980840 6:38146438-38146460 AGCCCTCGATTTCAAAGGGAGGG - Intronic
1010457180 6:76070118-76070140 TGCCCTGTATTTAAAATAGAAGG + Intronic
1011544569 6:88469341-88469363 TGCCCTTGGTTTCAAAGTTTGGG + Intergenic
1013200335 6:107888665-107888687 TGTGCTGGTTTTCAAAGAGAAGG + Intronic
1013532887 6:111036123-111036145 TAACATTGATTTCAAAGAGCAGG - Intergenic
1015128515 6:129783355-129783377 AGCCCTAGAATTCAAAGAGATGG + Intergenic
1015268813 6:131317654-131317676 TTCCCTAGATGTCAAAGGGATGG + Intergenic
1015754329 6:136592487-136592509 GGCTCTTGTTTTGAAAGAGAAGG + Exonic
1016120716 6:140338768-140338790 TGCCCTTGAGTACACAGAAAAGG + Intergenic
1016149343 6:140719954-140719976 TTACCTGGTTTTCAAAGAGATGG - Intergenic
1016907478 6:149166002-149166024 TGACTTTGTTTTCAACGAGAAGG - Intergenic
1018053766 6:160034547-160034569 TGCCCATGAATGCAAAGAGGAGG - Intronic
1018112915 6:160553539-160553561 TGCCATTGTTTCCAAGGAGAAGG + Intronic
1019069264 6:169328622-169328644 TGCTCTTGTTTTCCAGGAGAAGG - Intergenic
1019844368 7:3482347-3482369 GGCCCTTGAGTTCAGAAAGACGG - Intronic
1020603206 7:10302739-10302761 TCCCCTTGTTGTTAAAGAGAGGG - Intergenic
1020814346 7:12886708-12886730 TTCCATTGATTAAAAAGAGAAGG + Intergenic
1023123565 7:36933630-36933652 TGCCCTTCATCCCACAGAGACGG - Intronic
1024589716 7:50870838-50870860 TGCCCTTGATTTTAAACTCAAGG - Intergenic
1025604333 7:63028551-63028573 TGCCTTTGATTTCAGAGCGGCGG + Intergenic
1025798277 7:64760006-64760028 TGCCCTTGATTACACTGACAAGG + Intergenic
1026913401 7:74105929-74105951 TGCCATTGATTTCCAAGATCCGG - Exonic
1030276608 7:107727762-107727784 TCCCCTTTAGTTCAAACAGATGG + Intergenic
1030836742 7:114297076-114297098 TGCCCTTTATTTCAGGGAGAGGG + Intronic
1031456112 7:121981440-121981462 TGGCCTTAATCTCATAGAGAGGG + Intronic
1035791930 8:2314660-2314682 TGGCCATGAGTTCAAAGAGAAGG - Intergenic
1035800875 8:2407045-2407067 TGGCCATGAGTTCAAAGAGAAGG + Intergenic
1036503440 8:9334350-9334372 TCCCATTGCTTTCAAAGGGAAGG - Intergenic
1036758176 8:11485514-11485536 TGCCTTTAATTTAAAAGAAAAGG + Intergenic
1037927263 8:22853521-22853543 TACCCTTCTTTTCAGAGAGAGGG + Intronic
1039015380 8:33142412-33142434 TGCTTTGGTTTTCAAAGAGAAGG - Intergenic
1040428025 8:47308758-47308780 TGCCCTATATTTGGAAGAGAGGG + Intronic
1043686216 8:83089907-83089929 TGTCCTTCATTTCAAAGGGAAGG - Intergenic
1044176575 8:89131924-89131946 TACCCTTGACTTCAAATTGACGG - Intergenic
1044413562 8:91911051-91911073 TGCCATTGATTGAAATGAGATGG + Intergenic
1044549775 8:93498876-93498898 TGCCTTAGATTTCAAAAAGAGGG + Intergenic
1046614734 8:116463628-116463650 TACCCTGGTTTTCACAGAGAAGG + Intergenic
1046746417 8:117881049-117881071 TGCACTTGATTTCTACTAGATGG - Intronic
1047020357 8:120769134-120769156 TGCCCTGAATTTCAAATAGAGGG - Intronic
1047644227 8:126852665-126852687 TAGCAATGATTTCAAAGAGATGG + Intergenic
1049228382 8:141469019-141469041 TGCCCTTGATTGAAGGGAGATGG - Intergenic
1051349445 9:16185121-16185143 TGCCTTTGAGTGGAAAGAGAAGG - Intergenic
1052162256 9:25278713-25278735 TGCTCTTGATATTAGAGAGAAGG - Intergenic
1053099192 9:35355479-35355501 TGACCTTGAATGCAAAGTGAAGG - Intronic
1053335171 9:37262533-37262555 TCCCCTTGTTTGCAAAGAAAGGG + Intronic
1057772199 9:97978656-97978678 TGCCCTTATTTTCAAGGATAAGG + Intergenic
1058594481 9:106600967-106600989 TGGCCTTGCTTTCAGAGAGGAGG - Intergenic
1059246330 9:112852747-112852769 TGTATTTGTTTTCAAAGAGAGGG + Intronic
1060745420 9:126127804-126127826 TGCCCATGAGTTCACAAAGAAGG + Intergenic
1061648893 9:132030058-132030080 TGTCCTGGTTTTCAAAGACAGGG + Intronic
1186614672 X:11174156-11174178 TACCCTTGACTTCTAACAGAAGG + Intronic
1187467040 X:19537033-19537055 TGCTCTTGATTTCTCAGTGATGG - Intronic
1189718192 X:43886195-43886217 TTCCCTTGAGGTCAATGAGAAGG + Intergenic
1191998665 X:67124436-67124458 TGCCCTAGATATTAAAGAAAAGG + Intergenic
1198586498 X:138128153-138128175 TGCCCTTATTTTCACAGGGAGGG + Intergenic