ID: 1074753723

View in Genome Browser
Species Human (GRCh38)
Location 10:116609696-116609718
Sequence CGCGAGGCCGCCTCGACCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074753723_1074753727 -3 Left 1074753723 10:116609696-116609718 CCCTGGGTCGAGGCGGCCTCGCG No data
Right 1074753727 10:116609716-116609738 GCGGCCACCTAAGCACAGAGCGG No data
1074753723_1074753736 19 Left 1074753723 10:116609696-116609718 CCCTGGGTCGAGGCGGCCTCGCG No data
Right 1074753736 10:116609738-116609760 GCGCGGAGGCGGGGCCCAGGCGG No data
1074753723_1074753733 9 Left 1074753723 10:116609696-116609718 CCCTGGGTCGAGGCGGCCTCGCG No data
Right 1074753733 10:116609728-116609750 GCACAGAGCGGCGCGGAGGCGGG No data
1074753723_1074753734 10 Left 1074753723 10:116609696-116609718 CCCTGGGTCGAGGCGGCCTCGCG No data
Right 1074753734 10:116609729-116609751 CACAGAGCGGCGCGGAGGCGGGG No data
1074753723_1074753735 16 Left 1074753723 10:116609696-116609718 CCCTGGGTCGAGGCGGCCTCGCG No data
Right 1074753735 10:116609735-116609757 GCGGCGCGGAGGCGGGGCCCAGG No data
1074753723_1074753731 5 Left 1074753723 10:116609696-116609718 CCCTGGGTCGAGGCGGCCTCGCG No data
Right 1074753731 10:116609724-116609746 CTAAGCACAGAGCGGCGCGGAGG No data
1074753723_1074753737 20 Left 1074753723 10:116609696-116609718 CCCTGGGTCGAGGCGGCCTCGCG No data
Right 1074753737 10:116609739-116609761 CGCGGAGGCGGGGCCCAGGCGGG No data
1074753723_1074753729 2 Left 1074753723 10:116609696-116609718 CCCTGGGTCGAGGCGGCCTCGCG No data
Right 1074753729 10:116609721-116609743 CACCTAAGCACAGAGCGGCGCGG No data
1074753723_1074753732 8 Left 1074753723 10:116609696-116609718 CCCTGGGTCGAGGCGGCCTCGCG No data
Right 1074753732 10:116609727-116609749 AGCACAGAGCGGCGCGGAGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074753723 Original CRISPR CGCGAGGCCGCCTCGACCCA GGG (reversed) Intergenic
No off target data available for this crispr