ID: 1074754681

View in Genome Browser
Species Human (GRCh38)
Location 10:116615633-116615655
Sequence CTACTGTGGGAAGGAAGCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754681_1074754694 23 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754694 10:116615679-116615701 TGGTGCCATGGGCAGGCAAGTGG No data
1074754681_1074754692 16 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754692 10:116615672-116615694 GCCTTCTTGGTGCCATGGGCAGG No data
1074754681_1074754690 11 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754690 10:116615667-116615689 CTTGGGCCTTCTTGGTGCCATGG No data
1074754681_1074754695 24 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754695 10:116615680-116615702 GGTGCCATGGGCAGGCAAGTGGG No data
1074754681_1074754691 12 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754691 10:116615668-116615690 TTGGGCCTTCTTGGTGCCATGGG No data
1074754681_1074754688 3 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754688 10:116615659-116615681 GCTGGCACCTTGGGCCTTCTTGG No data
1074754681_1074754687 -6 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754687 10:116615650-116615672 CAGTAGACAGCTGGCACCTTGGG No data
1074754681_1074754686 -7 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754686 10:116615649-116615671 ACAGTAGACAGCTGGCACCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754681 Original CRISPR CTACTGTGGGAAGGAAGCGA AGG (reversed) Intergenic