ID: 1074754684

View in Genome Browser
Species Human (GRCh38)
Location 10:116615646-116615668
Sequence AGGTGCCAGCTGTCTACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754684_1074754690 -2 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754690 10:116615667-116615689 CTTGGGCCTTCTTGGTGCCATGG No data
1074754684_1074754697 30 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754697 10:116615699-116615721 TGGGAGTAAATGAGTGCTACTGG No data
1074754684_1074754694 10 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754694 10:116615679-116615701 TGGTGCCATGGGCAGGCAAGTGG No data
1074754684_1074754688 -10 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754688 10:116615659-116615681 GCTGGCACCTTGGGCCTTCTTGG No data
1074754684_1074754695 11 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754695 10:116615680-116615702 GGTGCCATGGGCAGGCAAGTGGG No data
1074754684_1074754691 -1 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754691 10:116615668-116615690 TTGGGCCTTCTTGGTGCCATGGG No data
1074754684_1074754692 3 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754692 10:116615672-116615694 GCCTTCTTGGTGCCATGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754684 Original CRISPR AGGTGCCAGCTGTCTACTGT GGG (reversed) Intergenic