ID: 1074754689

View in Genome Browser
Species Human (GRCh38)
Location 10:116615666-116615688
Sequence CATGGCACCAAGAAGGCCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754689_1074754700 23 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754700 10:116615712-116615734 GTGCTACTGGGTGGCAGCCTAGG No data
1074754689_1074754702 25 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754702 10:116615714-116615736 GCTACTGGGTGGCAGCCTAGGGG No data
1074754689_1074754701 24 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754701 10:116615713-116615735 TGCTACTGGGTGGCAGCCTAGGG No data
1074754689_1074754703 26 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754703 10:116615715-116615737 CTACTGGGTGGCAGCCTAGGGGG No data
1074754689_1074754697 10 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754697 10:116615699-116615721 TGGGAGTAAATGAGTGCTACTGG No data
1074754689_1074754698 11 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754698 10:116615700-116615722 GGGAGTAAATGAGTGCTACTGGG No data
1074754689_1074754695 -9 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754695 10:116615680-116615702 GGTGCCATGGGCAGGCAAGTGGG No data
1074754689_1074754699 14 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754699 10:116615703-116615725 AGTAAATGAGTGCTACTGGGTGG No data
1074754689_1074754694 -10 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754694 10:116615679-116615701 TGGTGCCATGGGCAGGCAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754689 Original CRISPR CATGGCACCAAGAAGGCCCA AGG (reversed) Intergenic
No off target data available for this crispr