ID: 1074754691

View in Genome Browser
Species Human (GRCh38)
Location 10:116615668-116615690
Sequence TTGGGCCTTCTTGGTGCCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754679_1074754691 26 Left 1074754679 10:116615619-116615641 CCCACAGGTGCTGACCTTCGCTT No data
Right 1074754691 10:116615668-116615690 TTGGGCCTTCTTGGTGCCATGGG No data
1074754680_1074754691 25 Left 1074754680 10:116615620-116615642 CCACAGGTGCTGACCTTCGCTTC No data
Right 1074754691 10:116615668-116615690 TTGGGCCTTCTTGGTGCCATGGG No data
1074754683_1074754691 3 Left 1074754683 10:116615642-116615664 CCTTCCCACAGTAGACAGCTGGC No data
Right 1074754691 10:116615668-116615690 TTGGGCCTTCTTGGTGCCATGGG No data
1074754685_1074754691 -2 Left 1074754685 10:116615647-116615669 CCACAGTAGACAGCTGGCACCTT No data
Right 1074754691 10:116615668-116615690 TTGGGCCTTCTTGGTGCCATGGG No data
1074754684_1074754691 -1 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754691 10:116615668-116615690 TTGGGCCTTCTTGGTGCCATGGG No data
1074754681_1074754691 12 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754691 10:116615668-116615690 TTGGGCCTTCTTGGTGCCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754691 Original CRISPR TTGGGCCTTCTTGGTGCCAT GGG Intergenic