ID: 1074754695

View in Genome Browser
Species Human (GRCh38)
Location 10:116615680-116615702
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754683_1074754695 15 Left 1074754683 10:116615642-116615664 CCTTCCCACAGTAGACAGCTGGC No data
Right 1074754695 10:116615680-116615702 GGTGCCATGGGCAGGCAAGTGGG No data
1074754689_1074754695 -9 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754695 10:116615680-116615702 GGTGCCATGGGCAGGCAAGTGGG No data
1074754685_1074754695 10 Left 1074754685 10:116615647-116615669 CCACAGTAGACAGCTGGCACCTT No data
Right 1074754695 10:116615680-116615702 GGTGCCATGGGCAGGCAAGTGGG No data
1074754681_1074754695 24 Left 1074754681 10:116615633-116615655 CCTTCGCTTCCTTCCCACAGTAG No data
Right 1074754695 10:116615680-116615702 GGTGCCATGGGCAGGCAAGTGGG No data
1074754684_1074754695 11 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754695 10:116615680-116615702 GGTGCCATGGGCAGGCAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754695 Original CRISPR GGTGCCATGGGCAGGCAAGT GGG Intergenic
No off target data available for this crispr