ID: 1074754696

View in Genome Browser
Species Human (GRCh38)
Location 10:116615684-116615706
Sequence TACTCCCACTTGCCTGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754696_1074754697 -8 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754697 10:116615699-116615721 TGGGAGTAAATGAGTGCTACTGG No data
1074754696_1074754701 6 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754701 10:116615713-116615735 TGCTACTGGGTGGCAGCCTAGGG No data
1074754696_1074754702 7 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754702 10:116615714-116615736 GCTACTGGGTGGCAGCCTAGGGG No data
1074754696_1074754703 8 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754703 10:116615715-116615737 CTACTGGGTGGCAGCCTAGGGGG No data
1074754696_1074754706 27 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754706 10:116615734-116615756 GGGGCCCAGCTGCCTGCCTTGGG No data
1074754696_1074754700 5 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754700 10:116615712-116615734 GTGCTACTGGGTGGCAGCCTAGG No data
1074754696_1074754698 -7 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754698 10:116615700-116615722 GGGAGTAAATGAGTGCTACTGGG No data
1074754696_1074754705 26 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754705 10:116615733-116615755 GGGGGCCCAGCTGCCTGCCTTGG No data
1074754696_1074754699 -4 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754699 10:116615703-116615725 AGTAAATGAGTGCTACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754696 Original CRISPR TACTCCCACTTGCCTGCCCA TGG (reversed) Intergenic