ID: 1074754697

View in Genome Browser
Species Human (GRCh38)
Location 10:116615699-116615721
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754693_1074754697 3 Left 1074754693 10:116615673-116615695 CCTTCTTGGTGCCATGGGCAGGC No data
Right 1074754697 10:116615699-116615721 TGGGAGTAAATGAGTGCTACTGG No data
1074754685_1074754697 29 Left 1074754685 10:116615647-116615669 CCACAGTAGACAGCTGGCACCTT No data
Right 1074754697 10:116615699-116615721 TGGGAGTAAATGAGTGCTACTGG No data
1074754696_1074754697 -8 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754697 10:116615699-116615721 TGGGAGTAAATGAGTGCTACTGG No data
1074754684_1074754697 30 Left 1074754684 10:116615646-116615668 CCCACAGTAGACAGCTGGCACCT No data
Right 1074754697 10:116615699-116615721 TGGGAGTAAATGAGTGCTACTGG No data
1074754689_1074754697 10 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754697 10:116615699-116615721 TGGGAGTAAATGAGTGCTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754697 Original CRISPR TGGGAGTAAATGAGTGCTAC TGG Intergenic