ID: 1074754698

View in Genome Browser
Species Human (GRCh38)
Location 10:116615700-116615722
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754693_1074754698 4 Left 1074754693 10:116615673-116615695 CCTTCTTGGTGCCATGGGCAGGC No data
Right 1074754698 10:116615700-116615722 GGGAGTAAATGAGTGCTACTGGG No data
1074754696_1074754698 -7 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754698 10:116615700-116615722 GGGAGTAAATGAGTGCTACTGGG No data
1074754685_1074754698 30 Left 1074754685 10:116615647-116615669 CCACAGTAGACAGCTGGCACCTT No data
Right 1074754698 10:116615700-116615722 GGGAGTAAATGAGTGCTACTGGG No data
1074754689_1074754698 11 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754698 10:116615700-116615722 GGGAGTAAATGAGTGCTACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754698 Original CRISPR GGGAGTAAATGAGTGCTACT GGG Intergenic
No off target data available for this crispr