ID: 1074754699

View in Genome Browser
Species Human (GRCh38)
Location 10:116615703-116615725
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754689_1074754699 14 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754699 10:116615703-116615725 AGTAAATGAGTGCTACTGGGTGG No data
1074754696_1074754699 -4 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754699 10:116615703-116615725 AGTAAATGAGTGCTACTGGGTGG No data
1074754693_1074754699 7 Left 1074754693 10:116615673-116615695 CCTTCTTGGTGCCATGGGCAGGC No data
Right 1074754699 10:116615703-116615725 AGTAAATGAGTGCTACTGGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754699 Original CRISPR AGTAAATGAGTGCTACTGGG TGG Intergenic