ID: 1074754700

View in Genome Browser
Species Human (GRCh38)
Location 10:116615712-116615734
Sequence GTGCTACTGGGTGGCAGCCT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754689_1074754700 23 Left 1074754689 10:116615666-116615688 CCTTGGGCCTTCTTGGTGCCATG No data
Right 1074754700 10:116615712-116615734 GTGCTACTGGGTGGCAGCCTAGG No data
1074754693_1074754700 16 Left 1074754693 10:116615673-116615695 CCTTCTTGGTGCCATGGGCAGGC No data
Right 1074754700 10:116615712-116615734 GTGCTACTGGGTGGCAGCCTAGG No data
1074754696_1074754700 5 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754700 10:116615712-116615734 GTGCTACTGGGTGGCAGCCTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754700 Original CRISPR GTGCTACTGGGTGGCAGCCT AGG Intergenic