ID: 1074754706

View in Genome Browser
Species Human (GRCh38)
Location 10:116615734-116615756
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074754696_1074754706 27 Left 1074754696 10:116615684-116615706 CCATGGGCAGGCAAGTGGGAGTA No data
Right 1074754706 10:116615734-116615756 GGGGCCCAGCTGCCTGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074754706 Original CRISPR GGGGCCCAGCTGCCTGCCTT GGG Intergenic