ID: 1074756505

View in Genome Browser
Species Human (GRCh38)
Location 10:116627804-116627826
Sequence CCGTGTGCGCGCCCAGGCTG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 208
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 196}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074756505_1074756516 2 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756516 10:116627829-116627851 GCGGAGGCGGGCAGGAGGCTGGG 0: 2
1: 0
2: 7
3: 70
4: 670
1074756505_1074756519 5 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756519 10:116627832-116627854 GAGGCGGGCAGGAGGCTGGGGGG 0: 1
1: 1
2: 9
3: 130
4: 1331
1074756505_1074756520 13 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756520 10:116627840-116627862 CAGGAGGCTGGGGGGCCGCGTGG 0: 1
1: 1
2: 7
3: 65
4: 641
1074756505_1074756515 1 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756515 10:116627828-116627850 CGCGGAGGCGGGCAGGAGGCTGG 0: 1
1: 1
2: 7
3: 71
4: 668
1074756505_1074756513 -3 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756513 10:116627824-116627846 CGGCCGCGGAGGCGGGCAGGAGG 0: 1
1: 0
2: 6
3: 80
4: 571
1074756505_1074756511 -10 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756511 10:116627817-116627839 GCGCACACGGCCGCGGAGGCGGG 0: 1
1: 0
2: 0
3: 17
4: 132
1074756505_1074756512 -6 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756512 10:116627821-116627843 ACACGGCCGCGGAGGCGGGCAGG 0: 1
1: 0
2: 0
3: 13
4: 166
1074756505_1074756525 30 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756525 10:116627857-116627879 GCGTGGGCAGGATCACAGGTAGG 0: 1
1: 0
2: 0
3: 13
4: 155
1074756505_1074756522 18 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756522 10:116627845-116627867 GGCTGGGGGGCCGCGTGGGCAGG 0: 1
1: 0
2: 7
3: 61
4: 755
1074756505_1074756521 14 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756521 10:116627841-116627863 AGGAGGCTGGGGGGCCGCGTGGG 0: 1
1: 0
2: 0
3: 36
4: 359
1074756505_1074756517 3 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756517 10:116627830-116627852 CGGAGGCGGGCAGGAGGCTGGGG 0: 1
1: 0
2: 1
3: 95
4: 889
1074756505_1074756523 26 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756523 10:116627853-116627875 GGCCGCGTGGGCAGGATCACAGG 0: 1
1: 0
2: 0
3: 14
4: 234
1074756505_1074756518 4 Left 1074756505 10:116627804-116627826 CCACAGCCTGGGCGCGCACACGG 0: 1
1: 0
2: 1
3: 10
4: 196
Right 1074756518 10:116627831-116627853 GGAGGCGGGCAGGAGGCTGGGGG 0: 1
1: 2
2: 15
3: 170
4: 1520

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074756505 Original CRISPR CCGTGTGCGCGCCCAGGCTG TGG (reversed) Exonic
900465997 1:2825774-2825796 CTGTGTAAGCGTCCAGGCTGTGG - Intergenic
900746386 1:4363499-4363521 CCCTGTTAGCTCCCAGGCTGTGG - Intergenic
901625311 1:10621038-10621060 CCGTGTGAGTGCCCACGCTAAGG - Intronic
902401926 1:16162593-16162615 CCCAGTGCGGACCCAGGCTGAGG - Intergenic
902876517 1:19343855-19343877 CCCTGAGAACGCCCAGGCTGAGG + Intronic
903808784 1:26023054-26023076 CAGTCTGGGCGTCCAGGCTGAGG - Exonic
905343138 1:37292976-37292998 CTGTGTGCAAGCCCAGCCTGAGG - Intergenic
908523480 1:64966424-64966446 CCCTGGGCGCGCGCACGCTGGGG - Exonic
916720871 1:167484020-167484042 CCGTGTGGGAGTCAAGGCTGGGG + Intronic
919250775 1:195054194-195054216 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
922725353 1:227920537-227920559 CCGTGCGGGTGCCCAGGCTCGGG - Exonic
924305874 1:242689297-242689319 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
1063416569 10:5877830-5877852 ACGTTTGCGCGATCAGGCTGTGG - Intronic
1063570914 10:7213777-7213799 CCGTGTGCGAGGCCATGGTGCGG + Intronic
1065521672 10:26579697-26579719 CCCTGTGCGGGCCCTGCCTGGGG - Intergenic
1065973502 10:30823260-30823282 CCCTGTGTGCGGCAAGGCTGAGG + Intronic
1066293553 10:34035267-34035289 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
1067108637 10:43382885-43382907 CAGTGTGCCCGGCCAAGCTGAGG - Intergenic
1068211262 10:53924055-53924077 CAGAGTGGGCGCCAAGGCTGAGG - Intronic
1071797132 10:89019063-89019085 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
1073442489 10:103560642-103560664 CCCTGTGCATGCCCAGGGTGGGG - Intronic
1074747905 10:116553768-116553790 CAGCGTGGGCACCCAGGCTGTGG - Exonic
1074752052 10:116596255-116596277 CCACGTGGGCTCCCAGGCTGTGG - Exonic
1074756505 10:116627804-116627826 CCGTGTGCGCGCCCAGGCTGTGG - Exonic
1076309851 10:129497586-129497608 CCGTGTTAGCGCCCTGGTTGTGG - Intronic
1076813153 10:132899457-132899479 CCCTGTGCTCACCAAGGCTGTGG - Intronic
1078371692 11:10751613-10751635 CCCTGTGCCCTCTCAGGCTGGGG + Intronic
1081671850 11:44946897-44946919 CTGTGTGCCAGTCCAGGCTGAGG - Intronic
1084120680 11:67067178-67067200 CCTTGGGCGGGCACAGGCTGGGG - Intronic
1084396169 11:68911920-68911942 CCGTGTGCACGCCCGTGCAGGGG + Intronic
1085045099 11:73348041-73348063 CCATGTGTGCATCCAGGCTGTGG - Intronic
1087682410 11:101231823-101231845 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
1092341373 12:7679265-7679287 GGCTGTGCACGCCCAGGCTGGGG - Intergenic
1093346202 12:18040127-18040149 CCGAGTGGGCGCTAAGGCTGAGG - Intergenic
1094843187 12:34350432-34350454 TCGAGTGCGCGCCCCGTCTGCGG - Intergenic
1099192375 12:79573791-79573813 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
1099413771 12:82361905-82361927 CAGAGTGGGCGCCAAGGCTGAGG + Intronic
1099450631 12:82802434-82802456 CAGAGTGGGCGCCAAGGCTGAGG + Intronic
1100142267 12:91633817-91633839 CAGAGTGGGCGCCCAGGCCGAGG - Intergenic
1101654057 12:106704554-106704576 CCCTGGGCAGGCCCAGGCTGAGG + Intronic
1104162203 12:126191531-126191553 CCGGGTGCGCTCCGAGGGTGTGG + Intergenic
1106411636 13:29515074-29515096 CCGTGTGCAGGAACAGGCTGTGG - Intronic
1109201797 13:59439783-59439805 CAGTGTGGGCGCCGAGGCCGAGG - Intergenic
1110497809 13:76190043-76190065 CACTGTGGGAGCCCAGGCTGAGG + Intergenic
1110609889 13:77475942-77475964 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
1112282755 13:98076760-98076782 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
1112487632 13:99834322-99834344 TCGTATGCCCTCCCAGGCTGTGG - Intronic
1113345993 13:109479156-109479178 TCGTGTGCGTGCAGAGGCTGAGG - Intergenic
1120215814 14:81679660-81679682 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
1121930352 14:97966522-97966544 CCTTGTGAGCCACCAGGCTGTGG - Intronic
1126055847 15:44729069-44729091 CGATGGACGCGCCCAGGCTGGGG - Exonic
1128455258 15:67828187-67828209 CCCTGTGCGCGGCAGGGCTGCGG + Intronic
1128742237 15:70091882-70091904 GCGTGTATGCGCGCAGGCTGAGG + Intronic
1129271515 15:74421635-74421657 CGGTGCGGGAGCCCAGGCTGGGG - Intronic
1129424612 15:75454658-75454680 GCGTGTGCGCGCCCACGAGGGGG - Intronic
1132385723 15:101398597-101398619 CGGTGTCGGCGCCCAGGCTCCGG + Intronic
1132828987 16:1918434-1918456 CCGCGCCCGCTCCCAGGCTGCGG - Exonic
1132830051 16:1923592-1923614 GCTTGTGAGGGCCCAGGCTGGGG - Intergenic
1133127304 16:3655357-3655379 CCCTGTGCTCTCCCAGGATGAGG + Exonic
1134229739 16:12419607-12419629 CTGTGTTCACGCCCAGGCTGTGG + Intronic
1135382977 16:22008951-22008973 CCGGGGGCGAGCCCGGGCTGCGG + Intronic
1137945635 16:52731291-52731313 CAGAGTGGGCGCCGAGGCTGAGG - Intergenic
1139341630 16:66271372-66271394 CTGTGTGTGAGCCCAGTCTGGGG - Intergenic
1142959627 17:3544531-3544553 CACTGTGCCCACCCAGGCTGGGG - Intronic
1144967749 17:19088865-19088887 CCGTGTCCGGGCCGAGGCAGGGG + Intergenic
1144980167 17:19163198-19163220 CCGTGTCCGGGCCGAGGCAGGGG - Intergenic
1144988055 17:19215034-19215056 CCGTGTCCGGGCCGAGGCAGGGG + Intergenic
1145272673 17:21413075-21413097 CCGCCTGCCCGGCCAGGCTGTGG - Intronic
1145310882 17:21700538-21700560 CCGCCTGCCCGGCCAGGCTGTGG - Intronic
1146352909 17:32110975-32110997 CCTTGTGTGAGCCCAGCCTGTGG - Intergenic
1146884845 17:36464075-36464097 CCTGGAGCGGGCCCAGGCTGGGG + Intergenic
1147170751 17:38617421-38617443 CAGTGTGCCCTCCCAGCCTGTGG + Intergenic
1150904847 17:69326795-69326817 CGGTGGGAGCGCCCAGGATGCGG - Intronic
1152296878 17:79472654-79472676 TTGTGTGAGCCCCCAGGCTGAGG + Intronic
1152424241 17:80210370-80210392 CCGTGTGGCCGGCCAGCCTGGGG - Exonic
1152601364 17:81263871-81263893 CCGTGTTCCCGCCCTGGCTCTGG - Intronic
1154202394 18:12308419-12308441 GCGGGTGCGCGCCCCGGCGGGGG - Intronic
1154279710 18:12991544-12991566 CCGGGTGGGGGCGCAGGCTGTGG + Intronic
1154437458 18:14357765-14357787 CCGCTGGCGCGTCCAGGCTGTGG - Intergenic
1156079438 18:33316101-33316123 CAGAGTGGGCGCCAAGGCTGAGG - Intronic
1156610557 18:38718869-38718891 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
1157858445 18:51121405-51121427 CAGAGTGGGCGCCCAGGCAGAGG + Intergenic
1158553801 18:58459264-58459286 CAGAGTGGGCGCCCAGGCAGAGG - Intergenic
1159322146 18:66866575-66866597 CCGAGTGGGCGCCAAGGCCGAGG - Intergenic
1160512486 18:79460445-79460467 CCGTGCACACACCCAGGCTGTGG + Intronic
1160531506 18:79567651-79567673 CCGTGGGGGCCCCCAGTCTGCGG + Intergenic
1160846736 19:1169327-1169349 ACGAGTGCGGCCCCAGGCTGAGG + Intronic
1160914507 19:1490274-1490296 CCTTGTCCGCCCCCGGGCTGTGG - Exonic
1161073445 19:2273709-2273731 CCATGCGCAGGCCCAGGCTGGGG - Intronic
1161273626 19:3403957-3403979 CCGTGTGTGCGCTCAGCCAGTGG + Intronic
1161953036 19:7478219-7478241 CCCTGTGCAGGCCCATGCTGGGG - Intronic
1162031478 19:7919251-7919273 CCGTGTGCACTCCCAGGCCATGG + Intergenic
1162079548 19:8209866-8209888 CCGTCTACGCGGCCGGGCTGCGG - Intronic
1162357449 19:10194861-10194883 CAGTGTGGGCACCCGGGCTGGGG + Exonic
1165340981 19:35212027-35212049 CCGTGGGCACACCCAGGCAGAGG + Intergenic
1165837730 19:38769954-38769976 TGGTGGGCGCGCCCAGGCTTGGG - Intergenic
1165999993 19:39872135-39872157 CCGTGTAGGCTGCCAGGCTGCGG + Exonic
1166305327 19:41934351-41934373 CCGTGTGCCTGCACATGCTGTGG + Intergenic
1166384186 19:42370964-42370986 CCCAGGGAGCGCCCAGGCTGGGG + Intronic
1166850797 19:45759831-45759853 CCCTGTTGTCGCCCAGGCTGGGG + Intronic
925345693 2:3170673-3170695 CCGTGTGTGCGCCGTGGCAGAGG - Intergenic
926037046 2:9643901-9643923 CCCTGTGGGAGGCCAGGCTGAGG + Intergenic
931614620 2:64143937-64143959 CCGCCTGCGCGCCCCCGCTGCGG - Intronic
938378840 2:130825478-130825500 CTGTGGGCCTGCCCAGGCTGTGG - Intergenic
938451427 2:131424974-131424996 CCGGACGCGCGCCCAGGCGGCGG - Intergenic
939969628 2:148644855-148644877 CGGGGTGGGCGCCCATGCTGTGG + Intronic
941904577 2:170708266-170708288 CAATGTGCTTGCCCAGGCTGGGG - Intergenic
942022089 2:171875879-171875901 TCTTGCGCTCGCCCAGGCTGTGG - Intronic
942301206 2:174564124-174564146 CTGGGTGCGCTCTCAGGCTGTGG + Intronic
943002932 2:182352070-182352092 CCGTGTGTGCACCAAGACTGTGG + Intronic
944252560 2:197592044-197592066 CAGAGTGGGCGCCCAGGCTGAGG + Intronic
944414165 2:199467027-199467049 CCGGCTGGCCGCCCAGGCTGAGG + Intronic
948202111 2:236136638-236136660 CCCTGTGCGAGCCCAGGCTGGGG - Intergenic
948214734 2:236220284-236220306 CAGTGGGAGAGCCCAGGCTGAGG - Intronic
948601409 2:239109349-239109371 CAGTGTGCTGGCCCAGGATGCGG + Intronic
948612682 2:239179790-239179812 CCGCGTGGGCTCTCAGGCTGTGG - Intronic
948737084 2:240016256-240016278 CCGTGTGCTCTGCCTGGCTGCGG - Intronic
1175593411 20:60211857-60211879 CCCTGTGCGCACCCACGCTGGGG + Intergenic
1176173862 20:63708485-63708507 CCGTGCCCGCCCTCAGGCTGTGG + Intronic
1176663155 21:9659908-9659930 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
1176839595 21:13827874-13827896 CCGCTGGCGCGTCCAGGCTGTGG + Intergenic
1178376845 21:32074227-32074249 CCGTGTGAGCCCCCGGCCTGTGG - Intergenic
1181529643 22:23509971-23509993 CTGTGTGAGTTCCCAGGCTGAGG + Intergenic
1181638607 22:24185568-24185590 CCAGGTGAGCCCCCAGGCTGGGG + Exonic
1182896124 22:33860865-33860887 CCGTGGGCGCAGCCAGCCTGAGG + Intronic
1183520977 22:38295857-38295879 CCGAGTGGGAGCCCAGGGTGAGG - Intronic
1184161610 22:42700550-42700572 CCCTGTGCGTGGCCAGGCTGGGG + Intronic
1185044473 22:48522340-48522362 CCGTCTGTGCCCACAGGCTGGGG + Intronic
1185155832 22:49192948-49192970 CCGTGGCCTCGCCCAGGCTGTGG + Intergenic
1185157535 22:49203220-49203242 CCGGGTGGGCTCCCAGCCTGAGG + Intergenic
1185375735 22:50481919-50481941 GCGGGTCCCCGCCCAGGCTGCGG - Exonic
950401087 3:12769347-12769369 CAGAGTGGGCGCCGAGGCTGAGG + Intronic
952867216 3:37862071-37862093 CGGCGGGCGCGCCCAGGCAGCGG + Intronic
953807800 3:46086393-46086415 CCCTGGGCGTGGCCAGGCTGAGG + Intergenic
955219599 3:57012757-57012779 CAGAGTGGGCGCCAAGGCTGAGG - Intronic
955507035 3:59642425-59642447 CTGTGTGCTGGCCCAGGCTTTGG + Intergenic
962671760 3:137714986-137715008 CAGAGTGGGCGCCCAGGCAGAGG + Intergenic
965615097 3:170585490-170585512 CGGGGTGCGCGCCAAGGCGGGGG + Intronic
969053047 4:4386393-4386415 GGGTGTGGGCGCCCAGGGTGAGG - Exonic
971231003 4:24800153-24800175 GCGTGTGCGGGCCCGGGCTCTGG + Exonic
971635034 4:29047390-29047412 CAGAGTGGGCGCCCAGGCTGAGG - Intergenic
976092336 4:81471601-81471623 CCGGGTGCGCTCCGAGGCGGCGG - Intronic
977507675 4:97923127-97923149 CAGAGTGGGCGCCCAGGCCGAGG - Intronic
977883531 4:102234213-102234235 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
978254958 4:106681941-106681963 CAGAGTGGGCGCCGAGGCTGAGG + Intergenic
980739187 4:136928880-136928902 CAGAGTGGGCGCCCAGGCTGAGG - Intergenic
980824175 4:138053387-138053409 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
981169621 4:141605826-141605848 CAGAGTGGGCGCCGAGGCTGAGG + Intergenic
984639167 4:182144232-182144254 ACGTGTACGCGCCCGGGCTCGGG + Intronic
985111946 4:186555369-186555391 CCCTGTGCGCGTCCCGGCCGCGG + Exonic
985409237 4:189665227-189665249 CCGAGTGGGCGCCGAGGCCGAGG + Intergenic
985412167 4:189696141-189696163 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
985512539 5:320856-320878 CAGGGTGCGAGGCCAGGCTGAGG + Intronic
985714305 5:1446721-1446743 CTGTGTGAGCCCCCAGGCTGTGG - Intergenic
993529258 5:89004101-89004123 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
994586830 5:101719476-101719498 CAGGGTGAGTGCCCAGGCTGTGG + Intergenic
995206737 5:109488338-109488360 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
997375431 5:133394227-133394249 CAGAGTGGGCGCCAAGGCTGAGG - Intronic
998142992 5:139710190-139710212 CCGCCTGTGCGCCTAGGCTGAGG + Intergenic
1001382245 5:171312339-171312361 TCCCGTGCGCACCCAGGCTGCGG - Intergenic
1002487791 5:179551135-179551157 ACGTGTGCGCGTCCGGGCTTCGG + Intronic
1002641219 5:180631535-180631557 CCGTGTGGTCTCCCAGGCTGTGG - Intronic
1004452460 6:15759244-15759266 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
1004883635 6:20032220-20032242 CAGAGTGGGTGCCCAGGCTGAGG - Intergenic
1005357086 6:24995221-24995243 CTCTGTGCACTCCCAGGCTGAGG - Intronic
1007413217 6:41677352-41677374 CCGGGGGAGTGCCCAGGCTGTGG + Intergenic
1007749892 6:44065426-44065448 CCTTGTTCGAGCCCAGGCTAAGG + Intergenic
1008567766 6:52786388-52786410 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
1009800654 6:68533308-68533330 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
1012551062 6:100465077-100465099 CCCTCCGCGCGCCCAGGCTCCGG + Intergenic
1017874900 6:158516361-158516383 ACAGGTGCGCGCGCAGGCTGAGG - Intergenic
1022174206 7:27857495-27857517 CAGAGTGGGCGCCAAGGCTGAGG + Intronic
1022942545 7:35254229-35254251 CGGAGGGCGCGCCCAGGGTGCGG + Intergenic
1023681685 7:42693948-42693970 GAGTGTGCGAACCCAGGCTGGGG - Intergenic
1026941077 7:74288453-74288475 CCCTGTCCATGCCCAGGCTGCGG - Intergenic
1027778888 7:82499488-82499510 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
1028857142 7:95605280-95605302 CAGAGTGGGCGCCCAGGCCGAGG - Intergenic
1030113097 7:106042930-106042952 CTGTGTGCGCCCACAGGGTGAGG + Intergenic
1032171308 7:129586998-129587020 CCCTGTGCTCACCCAGACTGGGG + Intergenic
1034262541 7:149765784-149765806 CCGTGTGCGTGCGCAGGTGGCGG + Exonic
1034424827 7:151009022-151009044 CCGGCTGAGCGCCCAGGCCGAGG + Exonic
1036059227 8:5296158-5296180 CTGTGTGCAAGCACAGGCTGAGG + Intergenic
1037576971 8:20215439-20215461 CTGTGTGTGTGCCCAGGATGGGG + Intronic
1039838848 8:41279339-41279361 CCGAGTGCTTGCCCAGGCCGGGG + Intronic
1047024671 8:120812250-120812272 GCGTGTGACCGCCGAGGCTGCGG - Intronic
1056199507 9:84261259-84261281 CCTTGTTCCCGCCCAGGCTAGGG - Intergenic
1056216200 9:84408353-84408375 CAGAGTGGGCGCCCAGGCAGAGG - Intergenic
1056953513 9:91064750-91064772 CTGTGTGCACACCCAGACTGTGG + Intergenic
1057726842 9:97574092-97574114 CAGAGTGGGCGCCAAGGCTGAGG - Intronic
1059385089 9:113958383-113958405 CCGTGTGCCAGCCCTGGCTCAGG - Intronic
1060051756 9:120383151-120383173 GTGTGTGCGCGCCCTGGCGGCGG - Intergenic
1060927873 9:127467887-127467909 CCCTGTGCCAGCCCAGGCTGGGG + Intronic
1061242710 9:129383640-129383662 CCGAGCGCGCGCCCAGCTTGGGG + Intergenic
1061517562 9:131098391-131098413 CTGTGTGCCTGCCCAGCCTGGGG + Intronic
1061577701 9:131517818-131517840 AGGTGTGCGCGCCCGGCCTGCGG + Intronic
1062335139 9:136061637-136061659 CCGTGTGAGGGCTGAGGCTGGGG - Intronic
1062530002 9:136995605-136995627 CAGTGTGCGAGGCCAGGCGGGGG + Intronic
1203662944 Un_KI270753v1:61857-61879 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
1203670427 Un_KI270755v1:6840-6862 CAGAGTGGGCGCCAAGGCTGAGG - Intergenic
1186486739 X:9939392-9939414 GCGTGTGCGTGTCCAGGCAGGGG + Intronic
1187237768 X:17484473-17484495 CCGTGTGGGCCCCCATGATGTGG - Intronic
1188881732 X:35499149-35499171 CGGAGTGGGCGCCCAGGCAGAGG - Intergenic
1195178452 X:102333577-102333599 CCGTTTGGGAGCCCAGACTGAGG - Intergenic
1195180412 X:102353506-102353528 CCGTTTGGGAGCCCAGACTGAGG + Intergenic
1195668472 X:107450311-107450333 TTGTGTGCGCGCCTGGGCTGTGG + Intergenic
1195909675 X:109876345-109876367 CAGAGTGGGCGCCAAGGCTGAGG + Intergenic
1198800135 X:140439718-140439740 CCGGGGGCGGGCCCGGGCTGGGG + Intergenic
1199094914 X:143726704-143726726 CAGAGTGGGCGCCGAGGCTGAGG + Intergenic