ID: 1074759310

View in Genome Browser
Species Human (GRCh38)
Location 10:116654548-116654570
Sequence CAGCTGCTTTAAGGGAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074759304_1074759310 -5 Left 1074759304 10:116654530-116654552 CCCCTTGAGGTGAAGCACCAGCT No data
Right 1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG No data
1074759301_1074759310 15 Left 1074759301 10:116654510-116654532 CCCATAGCTTTTTCTTCTGGCCC No data
Right 1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG No data
1074759305_1074759310 -6 Left 1074759305 10:116654531-116654553 CCCTTGAGGTGAAGCACCAGCTG No data
Right 1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG No data
1074759302_1074759310 14 Left 1074759302 10:116654511-116654533 CCATAGCTTTTTCTTCTGGCCCC No data
Right 1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG No data
1074759306_1074759310 -7 Left 1074759306 10:116654532-116654554 CCTTGAGGTGAAGCACCAGCTGC No data
Right 1074759310 10:116654548-116654570 CAGCTGCTTTAAGGGAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074759310 Original CRISPR CAGCTGCTTTAAGGGAACCA AGG Intergenic
No off target data available for this crispr