ID: 1074759412

View in Genome Browser
Species Human (GRCh38)
Location 10:116655111-116655133
Sequence GGTGCTCAACAACCCCATGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074759400_1074759412 27 Left 1074759400 10:116655061-116655083 CCTTCTCTCACCCCTTCCTTAGG No data
Right 1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG No data
1074759404_1074759412 15 Left 1074759404 10:116655073-116655095 CCTTCCTTAGGAGCCCTTCAGAG No data
Right 1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG No data
1074759408_1074759412 1 Left 1074759408 10:116655087-116655109 CCTTCAGAGCCAGGAATGAGTCC No data
Right 1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG No data
1074759410_1074759412 -8 Left 1074759410 10:116655096-116655118 CCAGGAATGAGTCCTGGTGCTCA No data
Right 1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG No data
1074759407_1074759412 2 Left 1074759407 10:116655086-116655108 CCCTTCAGAGCCAGGAATGAGTC No data
Right 1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG No data
1074759405_1074759412 11 Left 1074759405 10:116655077-116655099 CCTTAGGAGCCCTTCAGAGCCAG No data
Right 1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG No data
1074759403_1074759412 16 Left 1074759403 10:116655072-116655094 CCCTTCCTTAGGAGCCCTTCAGA No data
Right 1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG No data
1074759402_1074759412 17 Left 1074759402 10:116655071-116655093 CCCCTTCCTTAGGAGCCCTTCAG No data
Right 1074759412 10:116655111-116655133 GGTGCTCAACAACCCCATGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074759412 Original CRISPR GGTGCTCAACAACCCCATGC AGG Intergenic
No off target data available for this crispr