ID: 1074760999

View in Genome Browser
Species Human (GRCh38)
Location 10:116667535-116667557
Sequence CATTAGGACCAGAGTGAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074760991_1074760999 16 Left 1074760991 10:116667496-116667518 CCTCAGCTTGTCAGAACCCAAAG 0: 1
1: 0
2: 4
3: 34
4: 251
Right 1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG No data
1074760992_1074760999 0 Left 1074760992 10:116667512-116667534 CCCAAAGCCTATTCTCAACCAGC 0: 1
1: 0
2: 1
3: 7
4: 124
Right 1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG No data
1074760994_1074760999 -7 Left 1074760994 10:116667519-116667541 CCTATTCTCAACCAGCCATTAGG 0: 1
1: 0
2: 1
3: 10
4: 95
Right 1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG No data
1074760993_1074760999 -1 Left 1074760993 10:116667513-116667535 CCAAAGCCTATTCTCAACCAGCC 0: 1
1: 0
2: 1
3: 12
4: 106
Right 1074760999 10:116667535-116667557 CATTAGGACCAGAGTGAGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074760999 Original CRISPR CATTAGGACCAGAGTGAGGT TGG Intronic
No off target data available for this crispr