ID: 1074761135

View in Genome Browser
Species Human (GRCh38)
Location 10:116668322-116668344
Sequence CTCTGTTAGTGGAGGGAAGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 449
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 416}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074761130_1074761135 -10 Left 1074761130 10:116668309-116668331 CCATGATTTCGCTCTCTGTTAGT 0: 1
1: 1
2: 317
3: 85
4: 151
Right 1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG 0: 1
1: 0
2: 2
3: 30
4: 416

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074761135 Original CRISPR CTCTGTTAGTGGAGGGAAGA GGG Exonic
901263357 1:7890174-7890196 CACTCTTAATGGAGGGAGGAGGG - Intergenic
901807524 1:11747875-11747897 CTCTTTTAGGGGAGGGGATATGG + Intronic
901862212 1:12081509-12081531 CTCTCCTACTGGAGGGAGGAGGG + Intronic
902084516 1:13848748-13848770 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
903019792 1:20386063-20386085 CTGTGTTTCTGGAGGGCAGAAGG - Intergenic
904645931 1:31966305-31966327 CTCTGAGAATGGAGGAAAGAGGG + Intergenic
904688845 1:32278933-32278955 CTCTAATAGTGGAGGGCAGCTGG - Intronic
904891609 1:33783709-33783731 CAGTGTTAGTGTAGGAAAGATGG + Intronic
906319881 1:44809227-44809249 CTGAGTGAGTGGAGGGAGGAGGG - Intronic
907159811 1:52361709-52361731 CTCTGCTGTGGGAGGGAAGAGGG - Intronic
908062449 1:60366764-60366786 TTCTGGGAGAGGAGGGAAGAGGG + Intergenic
909960496 1:81834972-81834994 CTCTGTTCGTGAAGGGAAAAAGG - Intronic
910384299 1:86664758-86664780 CTCTCTTTGAGGAGAGAAGAGGG + Intergenic
911101383 1:94098515-94098537 CTCTGTTAGAGGAGGTAAAGGGG + Intronic
911530354 1:99036672-99036694 CTCTGCTAGGGCAGTGAAGAAGG - Intergenic
911724944 1:101233384-101233406 CTGGGTCAGGGGAGGGAAGAGGG + Intergenic
911812125 1:102296099-102296121 CTCTGCTAGAGAAGTGAAGAAGG + Intergenic
911897253 1:103452327-103452349 CTCTCTCAATGAAGGGAAGAAGG + Intergenic
911977801 1:104523710-104523732 GTCTGTTAGAGGAGTAAAGATGG + Intergenic
912067403 1:105761235-105761257 CACTGACAGTGGAGGAAAGAAGG + Intergenic
912084041 1:105977031-105977053 CTCTGCTAGTGCAGTGCAGAAGG + Intergenic
912121708 1:106479635-106479657 TTCTGTTAGGGCAGTGAAGAAGG + Intergenic
912165690 1:107039990-107040012 CTCTGCTAGAGCAGTGAAGAAGG + Intergenic
913018579 1:114764227-114764249 CTCTGCTAGGGGAGTGAAGAAGG + Intergenic
913307805 1:117450901-117450923 CTCTGCTAGGGGAGGGCCGAAGG + Intronic
913314906 1:117541316-117541338 CTCTGTTTGTGGAGAAAAGAAGG + Intergenic
913447821 1:118968842-118968864 CTCTTTTTGAGGAGGGAGGAGGG + Intronic
914804620 1:150983108-150983130 GTCTGTGACTGGCGGGAAGATGG + Exonic
915244298 1:154545192-154545214 CTCTGGAAGGGGAGAGAAGAGGG + Intronic
915689598 1:157675660-157675682 CTCTGCTAGTGCAGTGCAGAAGG + Intronic
916102220 1:161402364-161402386 CTCTTTCAGTGTAGGGATGATGG - Intergenic
918105810 1:181414085-181414107 CTCTGTTTGTGTAGGGCAAAAGG + Intronic
918167592 1:181965278-181965300 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
918412011 1:184269432-184269454 CTCTCTTATTTGAGAGAAGAGGG + Intergenic
919885191 1:201928499-201928521 CTCTGTGAGTGCTGTGAAGAGGG + Intronic
920349298 1:205327350-205327372 CTGTGTTAAGGGAGGGAGGAAGG + Intergenic
920895911 1:210049264-210049286 CTCTGCTAGGGCAGGGCAGAAGG - Intronic
922994847 1:229947703-229947725 CTATGTTCGAGGAAGGAAGAAGG + Intergenic
923040159 1:230314174-230314196 GTCTGACGGTGGAGGGAAGATGG + Intergenic
924613987 1:245597493-245597515 TGCTGTTAGTCTAGGGAAGATGG + Intronic
1063225179 10:4008847-4008869 CTGTGTTAGTTAAAGGAAGATGG - Intergenic
1064103739 10:12484338-12484360 CTCTGTGTTTGGAGGGAGGAGGG + Intronic
1064787541 10:18915373-18915395 CCCTCTTAGTGGTGGGAAGTGGG + Intergenic
1066633294 10:37477801-37477823 CTTTGTTTGGGGAGGGTAGACGG - Intergenic
1067544601 10:47183939-47183961 CTCTGTGGTTGGAGGGCAGAGGG + Intergenic
1067573181 10:47386458-47386480 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1067934051 10:50593062-50593084 CTCTGTTTTCGGAGGGAAGCTGG + Intronic
1068289955 10:54989238-54989260 CTCTGTTAGAGCAGTGTAGAAGG + Intronic
1068411427 10:56660630-56660652 CTCTGCTTGAGGAAGGAAGATGG - Intergenic
1068872737 10:61962777-61962799 CACTGTTAGTCGATGGATGAAGG - Intronic
1069368020 10:67714072-67714094 CTCTGCTAGGGCAGTGAAGAAGG + Intergenic
1070664260 10:78332363-78332385 CTCTGTTACTTGAAGGCAGACGG + Intergenic
1071245018 10:83752735-83752757 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1071319441 10:84438491-84438513 CTCTGGAAGGGCAGGGAAGAAGG - Exonic
1071552965 10:86581501-86581523 CTCTGTGAGTAGAGGGAGGTTGG - Intergenic
1071814422 10:89218470-89218492 TTCTGTTACTGAAAGGAAGAAGG - Intronic
1072098318 10:92204649-92204671 CTCTTCTAGTGGAAGGAAAATGG + Intronic
1073284832 10:102381349-102381371 GTCTGTGAGCCGAGGGAAGAAGG + Intronic
1073702500 10:105944221-105944243 CTCTGTGAGAGGAGGTTAGAGGG + Intergenic
1073880317 10:107973436-107973458 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1073990944 10:109261607-109261629 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1074302033 10:112241800-112241822 CTCTGTTTGTTGGGGGAAGTAGG - Intergenic
1074761135 10:116668322-116668344 CTCTGTTAGTGGAGGGAAGAGGG + Exonic
1074786792 10:116849051-116849073 CTCTGTTGGGGGAGGGATGTAGG - Intergenic
1074967374 10:118503308-118503330 CTCTGTTATGGGAGTCAAGAAGG - Intergenic
1074969680 10:118525860-118525882 CTCTATTTCTGAAGGGAAGAAGG + Intergenic
1075690861 10:124393202-124393224 CTCTGCCAGTGAAGGGCAGAGGG + Intergenic
1076532101 10:131151735-131151757 CTCTGTTAGGGCAGTGAAGAAGG - Intronic
1077484283 11:2831757-2831779 CTCTGGTGGGGGAGGGAGGAGGG - Intronic
1077838317 11:5944928-5944950 TGCTGTCAGTGGAGGGAGGACGG - Intergenic
1079310219 11:19358740-19358762 CTGTGTAAGAGGTGGGAAGAGGG - Intronic
1080183041 11:29446561-29446583 CTCTGTTAGGGCAGAGCAGAAGG + Intergenic
1080695884 11:34602692-34602714 GTATGCTAGTGGAGGGGAGACGG + Intergenic
1080717567 11:34818837-34818859 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
1080739338 11:35049223-35049245 CTCTGCTAGGGCAGTGAAGAAGG + Intergenic
1083027033 11:59559746-59559768 TTCTGTTGGTGGGAGGAAGAGGG - Intergenic
1083031388 11:59596147-59596169 GTCTTTCAGTGTAGGGAAGAGGG - Intronic
1083121849 11:60520853-60520875 CTCTGCTAGGGCAGGGCAGAAGG - Intronic
1083447889 11:62722195-62722217 CTCTTCTGGTGGTGGGAAGAAGG + Exonic
1083602495 11:63957739-63957761 TTCTGTGAATGGATGGAAGAGGG - Intergenic
1083990903 11:66245111-66245133 CTCTGCAGGTGGAGGGAATAGGG + Intergenic
1084554570 11:69868215-69868237 CTCTGCCGGTGGACGGAAGAAGG - Intergenic
1085503304 11:77041269-77041291 CTGGGGTAGTGGTGGGAAGAAGG - Exonic
1085649234 11:78252398-78252420 CTCTAATAGTGGAGGAGAGAGGG + Intronic
1085699002 11:78729685-78729707 CTCACCGAGTGGAGGGAAGATGG + Intronic
1086287983 11:85271384-85271406 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1086453535 11:86940147-86940169 CACTGTTAGTGGAGGGGACAGGG - Intronic
1086765848 11:90694080-90694102 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1086995716 11:93353537-93353559 CTCTGCTAGGGCAGGGCAGAAGG - Intronic
1087438328 11:98151237-98151259 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1088627768 11:111744023-111744045 CTGTGTAAGTGGAGAGAAGCGGG + Intronic
1088740752 11:112765071-112765093 CTGGGCTAGTGCAGGGAAGAGGG + Intergenic
1090172044 11:124613647-124613669 CTCTGTTAGGGGAGGGAAAGAGG + Intronic
1090499357 11:127246763-127246785 TTTTGTTGGTGGAGGGAAGGGGG + Intergenic
1090800370 11:130167608-130167630 CTGTGATAGGGGAGGGAAGGGGG - Intronic
1091191729 11:133701315-133701337 CACTGTTAGTGCAGGGGAGGCGG - Intergenic
1093930065 12:24947156-24947178 GTGTGTGTGTGGAGGGAAGACGG - Intronic
1094786878 12:33859144-33859166 CTCTGCTAGGGGAGTGTAGAAGG - Intergenic
1096483548 12:51959809-51959831 ATTTGTGAGTGGAGGGGAGAGGG + Intronic
1096718612 12:53505448-53505470 CTCTGTTACTGGGGTGAGGAGGG + Intronic
1097489079 12:60241801-60241823 ATCTGTTAGTGGAGTGAAGGTGG - Intergenic
1097492707 12:60290763-60290785 CTCTGCTAGAGCAGTGAAGAAGG + Intergenic
1098115591 12:67173099-67173121 GTGTGTTAGTGGGGGGATGAAGG - Intergenic
1098553445 12:71791476-71791498 GTTTTTTATTGGAGGGAAGAAGG + Exonic
1099618061 12:84964356-84964378 CTCTGTGAGAGAAGGAAAGAGGG - Intergenic
1099712507 12:86245144-86245166 TTCTATTAGTGAAGGGTAGATGG - Intronic
1099781350 12:87199907-87199929 CTCTGCTAGTGGTGGTAAAAAGG - Intergenic
1100955501 12:99903455-99903477 CTCTGTAATTGGAGGGAATAAGG + Intronic
1101838256 12:108310193-108310215 GTGTGTTAGGGGAGGGGAGAAGG + Intronic
1101999689 12:109549273-109549295 ATCTCTCAGTGGTGGGAAGATGG - Intergenic
1103168481 12:118791718-118791740 CTCAGATATTGCAGGGAAGATGG + Intergenic
1104101985 12:125621381-125621403 CTCTTTGAGTAGAGGGAAGGGGG + Intronic
1104240513 12:126984727-126984749 CTCTGCTAGGGCAGTGAAGAAGG - Intergenic
1104714149 12:131005536-131005558 CTCTGCGTGTGGAGGGCAGACGG + Intronic
1105650510 13:22372159-22372181 CTCTGCTAGGGAAGTGAAGATGG - Intergenic
1105719244 13:23097882-23097904 TTCTGTCAGTGTAGGAAAGAAGG - Intergenic
1105767321 13:23574734-23574756 CTCTGTGATGGGAGGGCAGAGGG + Intronic
1106713550 13:32364514-32364536 CTGTATTAGTAGAGGGAAGATGG - Intronic
1106718798 13:32418472-32418494 CTCTGCTAGTGCAGTGCAGATGG + Intronic
1108811682 13:54232664-54232686 CTCGGTTATAGGAGGGAAGCCGG - Intergenic
1109286030 13:60409258-60409280 CTCTGTTAGTGTAGTGCAGAAGG + Intronic
1109576310 13:64263747-64263769 CTCTGCTAGGGCAGGGCAGAAGG + Intergenic
1110362415 13:74642661-74642683 CTTTGTTAGTGGAGTGGAGTGGG + Intergenic
1110434320 13:75462514-75462536 CTCTGAGGGTGGAGGGTAGAGGG + Intronic
1110884282 13:80613786-80613808 TTCTTTTCTTGGAGGGAAGATGG + Intergenic
1111050920 13:82882631-82882653 CTCTGTTAGGGCAGTGCAGAGGG + Intergenic
1111076956 13:83249199-83249221 TTCTGTTAGAGGAGAGGAGAAGG - Intergenic
1111421649 13:88019055-88019077 CTCTGTTAGGGCAGTGAGGAAGG + Intergenic
1111500117 13:89107632-89107654 CTCTCTTAGTGAAGTGAAGGAGG - Intergenic
1112646657 13:101340433-101340455 CTGTGTTATTTGAGGGAAAATGG - Intronic
1112857192 13:103786428-103786450 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1113865258 13:113517803-113517825 GACTGTGGGTGGAGGGAAGAGGG + Intronic
1114427228 14:22634106-22634128 TTCTGCAAGTGGAAGGAAGAAGG - Exonic
1114808155 14:25862126-25862148 CATTGGAAGTGGAGGGAAGATGG + Intergenic
1115243288 14:31270353-31270375 CTCTGCTGGTGGAGGGAAGAGGG - Intergenic
1115925189 14:38425403-38425425 CTCTGCTTGAGGAGGGATGAAGG - Intergenic
1116225100 14:42140326-42140348 CACTGTTAGAAGAGGGAACAGGG - Intergenic
1118033241 14:61838765-61838787 CTATGTTATTGGAAGGGAGAAGG + Intergenic
1118303534 14:64635886-64635908 CTATGGAAGTGGAGGGGAGATGG - Intergenic
1118692163 14:68350698-68350720 CTGATTTAGTGGAGGGGAGATGG + Intronic
1119414258 14:74459123-74459145 CTCTGTCTCTGGAGGGGAGAGGG + Intergenic
1119601490 14:75979915-75979937 CTGTGTGTGTGGAAGGAAGAGGG - Intronic
1122710424 14:103652821-103652843 CTTTGTTAGTGGAGTGGAGGTGG + Intronic
1123508587 15:20972089-20972111 CTCTGCCTGTGGAAGGAAGAGGG - Intergenic
1124203972 15:27701808-27701830 CCCTGTTGCTGGAGGGAGGAAGG + Intergenic
1126330158 15:47523089-47523111 CACTGTTAGCAGATGGAAGATGG - Intronic
1126378835 15:48025046-48025068 TACTGGTAGTGGTGGGAAGAGGG - Intergenic
1126458977 15:48895418-48895440 CTATGTTAGGGGAGTGAACAAGG - Intronic
1126572740 15:50169096-50169118 CTCTGGTAGTGGAAGAAAAACGG + Intronic
1126942807 15:53784723-53784745 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1127293518 15:57591102-57591124 CTCTGTTAGGGGACAGCAGAGGG + Intergenic
1128599655 15:68985227-68985249 CTATGTCAGAGGAGGGCAGATGG + Intronic
1129535937 15:76313719-76313741 CTATGGGAGTGGAAGGAAGAGGG + Intergenic
1130079702 15:80721839-80721861 CTTTGTTTCTGGAGGGAAGGAGG + Intronic
1130099142 15:80878892-80878914 CTGGGGCAGTGGAGGGAAGAGGG - Intronic
1130409303 15:83631411-83631433 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
1130422017 15:83757194-83757216 CTCTGCTAGGGCAGTGAAGAAGG - Intronic
1133725466 16:8533389-8533411 CTCTGTGAGTTCATGGAAGATGG + Intergenic
1135156633 16:20058473-20058495 TTGTGTTGGTGGAGGGAATAGGG + Intronic
1136173744 16:28503806-28503828 GTCTGTTAGTGGGGGCCAGAAGG + Intronic
1136254647 16:29029899-29029921 CTCTGTTAGGGGTGGTGAGAAGG + Intergenic
1140661446 16:77193909-77193931 CTCTGTCAGTGGCGGGAGGTGGG + Intronic
1203141176 16_KI270728v1_random:1767805-1767827 CTGTGTTACTGGTGGGAGGAGGG + Intergenic
1142938727 17:3362715-3362737 CTCTGCTAGTGGAGTGCTGAGGG - Intergenic
1143383724 17:6512399-6512421 CTCAGTGACTGAAGGGAAGAGGG + Intronic
1143773165 17:9181149-9181171 CTTTGTTAGAGGAGGAGAGAAGG - Intronic
1144168790 17:12638390-12638412 CCCTTTTATTGGAGGGGAGAAGG - Intergenic
1146672601 17:34751988-34752010 CTCTCAAAGTGGAGGGGAGAAGG + Intergenic
1149207625 17:54266594-54266616 GTCTGGGAGTGAAGGGAAGAAGG + Intergenic
1149685671 17:58533153-58533175 CTCAGCCAGGGGAGGGAAGAGGG + Intronic
1150602594 17:66663663-66663685 CTTTGTTGGGGGAGGGAGGATGG + Intronic
1152030256 17:77837929-77837951 CTCTGTTAGGGGAGGTACAAAGG + Intergenic
1152080392 17:78183820-78183842 CTCTGTTTAGGGAGGGAAGAGGG - Intronic
1152850388 17:82630370-82630392 CGCTGTTGGTTGAGGAAAGAGGG - Intronic
1152862250 17:82703221-82703243 CTCTGCTTCTGAAGGGAAGAGGG - Intergenic
1153166535 18:2267941-2267963 CTCTATTAGTGGAGATCAGAGGG - Intergenic
1153846094 18:9051118-9051140 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1155147558 18:23096768-23096790 CTCAGTGAGTGGAGGGAACCAGG + Intergenic
1155250810 18:23951599-23951621 CCCGGTTTGGGGAGGGAAGATGG + Intronic
1156266402 18:35491875-35491897 CTCTGTTAGTGCTGCAAAGAGGG - Intronic
1157003074 18:43550306-43550328 CTCTGCTAGGGCAGTGAAGAAGG - Intergenic
1157871692 18:51235366-51235388 CTGTGAAAATGGAGGGAAGATGG - Intergenic
1159215593 18:65387110-65387132 CTCTGCTAGGGCAGGGCAGAAGG + Intergenic
1159446252 18:68544926-68544948 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1159461177 18:68723909-68723931 CTCTACTAGGGGAGGGCAGAAGG - Intronic
1159561204 18:69996885-69996907 CTCTTTTAGTTCAGTGAAGAGGG - Intergenic
1159756352 18:72370815-72370837 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1161458511 19:4382137-4382159 CTCTGACAATGGAGGGAGGAGGG - Intronic
1162292831 19:9792313-9792335 CTCAGTGAGGGGAGAGAAGAGGG - Intronic
1162292893 19:9792523-9792545 CTCGGTGAGGGGAGAGAAGAGGG - Intronic
1164875039 19:31678728-31678750 CTCTCTTGGTGGAGGGATGTGGG + Intergenic
1166259298 19:41626863-41626885 CTCTGGGAGTGGTGGGAAGAGGG - Intronic
1166541120 19:43606721-43606743 CTCTGTAAGTGCTGGGAAAATGG + Intronic
1168717908 19:58539842-58539864 CTCTGTCTGAGGAGGGAAGCAGG - Intergenic
925246625 2:2389141-2389163 CTCTGCTAGGGCAGTGAAGAAGG - Intergenic
926952150 2:18254280-18254302 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
927611844 2:24549038-24549060 CTCTGTTAGGGCAGTGCAGAAGG - Intronic
927723464 2:25402918-25402940 CTTTCTTAGTAGAAGGAAGAAGG + Intronic
929610731 2:43268950-43268972 CTCTGTCAGGGGTGGCAAGATGG - Intronic
929660553 2:43780081-43780103 GACTGTTAGTGGGGGGAAGAGGG + Intronic
930707698 2:54520853-54520875 CTCTGCTATTAGAGGGATGAGGG + Intronic
930998249 2:57748892-57748914 CTGCTTTAGTGAAGGGAAGATGG - Intergenic
931178587 2:59877467-59877489 CACTGTTTGGGGAGGGAAGGGGG - Intergenic
932935661 2:76098417-76098439 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
933729254 2:85444910-85444932 GTCTGTGAATGGAGGGGAGAGGG + Intergenic
933790782 2:85882225-85882247 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
934232053 2:90192943-90192965 CTATGTTAAGGGAGGCAAGAAGG - Intergenic
934884409 2:98012008-98012030 CACTGCTAATGGAGGGAGGAAGG + Intergenic
935323031 2:101906939-101906961 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
935981660 2:108634194-108634216 GTCTGTAGGGGGAGGGAAGAAGG + Intronic
936896374 2:117432513-117432535 CTCAGATAGTGGAAGGAATAAGG + Intergenic
937527530 2:122788996-122789018 CTCTGCTAGGGCAGTGAAGAAGG + Intergenic
939506423 2:143052774-143052796 CTCTGCTAGGGCAGTGAAGAAGG + Exonic
939667532 2:144969462-144969484 CTCTGATAGAGGAGTGCAGAAGG - Intergenic
939740729 2:145902436-145902458 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
940979972 2:159990615-159990637 CTCTGTTAGAGGAGAGAAGAAGG - Intronic
941445235 2:165591851-165591873 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
941509478 2:166387726-166387748 CTCTGATAATGCTGGGAAGAAGG + Intergenic
942782868 2:179667121-179667143 CCCTTTTGGTGGGGGGAAGAGGG - Intronic
942880707 2:180857633-180857655 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
944133206 2:196369758-196369780 CTCTGTTTGTGGAAAGATGAGGG - Intronic
944800183 2:203231317-203231339 CTCTGCTAGTGCAGTGCAGAAGG + Intergenic
944990471 2:205229881-205229903 CTCTGCTTGTGGAAAGAAGAGGG - Intronic
945457112 2:210063320-210063342 CTCTGCTAGGGGAGTGCAGAAGG + Intronic
945724868 2:213463745-213463767 CTCTGCTAGGGGAGTGCAGAAGG + Intronic
946442148 2:219705573-219705595 CATTTTTAGTGGAGAGAAGAAGG + Intergenic
946907406 2:224430047-224430069 CTCAGTTGGTAGAGGGGAGATGG + Intergenic
946968660 2:225067639-225067661 CTCTGTTAGGGCAGTGAGGAAGG + Intergenic
948152003 2:235751879-235751901 ATACGTTAGTGGAGGGAAGAAGG - Intronic
948223198 2:236289647-236289669 CTCTGTTGGTGGTGAGAAGGAGG + Intergenic
1168923603 20:1561095-1561117 CTCTGGTAGTGGACAGAGGAAGG + Intronic
1169136429 20:3200523-3200545 CCCTGTTAGGGGAGGGACGAGGG - Intronic
1169580962 20:7022801-7022823 CTCTGCTAGGGTAGTGAAGAAGG + Intergenic
1171772060 20:29330481-29330503 CTCGGTCAGTGGAGCCAAGAGGG + Intergenic
1173596528 20:44262172-44262194 CTCTGGTAGGGGTGGGGAGAAGG + Intronic
1174327369 20:49790035-49790057 CTCTGGTCGGGGAGGGAAGTAGG - Intergenic
1174966125 20:55217575-55217597 CTCTGTTAGTAGGATGAAGATGG + Intergenic
1175065038 20:56277195-56277217 CTCTGATAGTGGAGCAAAGTTGG + Intergenic
1177773145 21:25539450-25539472 CACTGCTTGTGGAGGGCAGAGGG - Intergenic
1180572556 22:16741620-16741642 GTCTGTTAGTGGGGGGCAGGAGG - Intergenic
1181795031 22:25301830-25301852 CTCTGGGAGCGGAGGGAAAAAGG + Intergenic
1181835602 22:25605497-25605519 CTCTGAGAGTGGAGGGAAAAAGG + Intronic
949480376 3:4488631-4488653 CCTTGTGAGTGGAGGGAACATGG - Intergenic
949847849 3:8390100-8390122 CTCTGTTAACTGAGGGAACAGGG + Intergenic
949932478 3:9089699-9089721 TTCTGTTAGTAGAAGGAGGAAGG - Intronic
950546121 3:13639070-13639092 CACTGTGGGTGGAGGGAAGCAGG + Intergenic
954055113 3:48016694-48016716 CTGTGTTAGAGGAAGGAAGTGGG - Intronic
956920784 3:73926985-73927007 CACAGTTAGGGCAGGGAAGAAGG + Intergenic
956938574 3:74131785-74131807 CTCTGTTAGGGCAGGGCAGAGGG - Intergenic
957036379 3:75297049-75297071 CTGTGAGTGTGGAGGGAAGAAGG - Intergenic
957105129 3:75877266-75877288 ATCTGTTAGTGGGGGGCAGGAGG + Intergenic
957374327 3:79336614-79336636 CTCTGCTAGGGCAGTGAAGAAGG + Intronic
958050275 3:88335696-88335718 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
959756487 3:109905859-109905881 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
959941155 3:112082993-112083015 CTCGGTTAGGGGATGGAGGAGGG + Intergenic
960410510 3:117317808-117317830 AAATGTTAGTGAAGGGAAGAAGG + Intergenic
960884729 3:122382977-122382999 CTCTGTAGGAGGAGGGAGGAGGG - Intronic
961704765 3:128775354-128775376 CTCTGCTAGTGGAGGAAGGGTGG - Intronic
961789346 3:129364685-129364707 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
962344640 3:134610260-134610282 CTGTGTACCTGGAGGGAAGATGG - Exonic
963908179 3:150791503-150791525 CTCTGTGTGTGGAGGGCACATGG - Intergenic
965108398 3:164388131-164388153 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
965777031 3:172242354-172242376 CTCTGCTAGGGTAGGGCAGAAGG - Intronic
967462279 3:189760753-189760775 CTCTATTAGGGCAGGGCAGAAGG - Intronic
967674777 3:192283920-192283942 CTCTGGTAGAGCAGGAAAGAAGG - Intronic
968283161 3:197492246-197492268 CTGTGTTAGAGGAGGGGAGGAGG + Intergenic
968295152 3:197570780-197570802 CTCTGCTAGGGCAGTGAAGAAGG + Intronic
968582421 4:1401305-1401327 CTCTGCCAGCGGAGGGAGGAGGG + Intergenic
969355121 4:6620649-6620671 CTCAGTTGGTGGTGGGAGGAAGG + Intronic
969500077 4:7547329-7547351 CTCTGGAAGTGGAGGGAAGTGGG - Intronic
970120185 4:12745180-12745202 CTCTGGTTGGGAAGGGAAGAAGG - Intergenic
970357424 4:15269674-15269696 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
970407927 4:15781295-15781317 GACTGTTAGTGCAGGCAAGATGG - Intronic
970408096 4:15782832-15782854 GACTGTTAGTGCAGGCAAGATGG - Intronic
970686970 4:18579436-18579458 CTCTGTTATTTGTGGAAAGATGG - Intergenic
971451755 4:26807313-26807335 CTCTGTCCAAGGAGGGAAGAAGG + Intergenic
971670237 4:29546613-29546635 CTCTGCTAGGGCAGGGCAGAAGG - Intergenic
971672088 4:29574721-29574743 CTTTCTTATTGGAGAGAAGAGGG + Intergenic
971815093 4:31477022-31477044 CTCTGCTAGAGCAGTGAAGAAGG + Intergenic
972063454 4:34910230-34910252 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
973345167 4:49047356-49047378 CTATGCTGGTGGAGGGAGGATGG + Intronic
973789498 4:54365150-54365172 CTCTGCTAGTGTAGGGAGGAAGG - Intergenic
974295536 4:59994320-59994342 CTCTGCTGGTGGAGGGCAGAGGG + Intergenic
975361288 4:73475036-73475058 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
975485316 4:74928843-74928865 CTCAGTTAGTAGATGGCAGAGGG + Intergenic
975834298 4:78405759-78405781 CTCTGATAGTGGGAGGGAGAGGG - Intronic
975835055 4:78413876-78413898 CTCTGTCTGGGGAGGGGAGAGGG + Intronic
977015344 4:91685319-91685341 CTGTGTTAGTAGAGAAAAGAAGG - Intergenic
977723860 4:100271362-100271384 CTCTTGTGGTGGAGGAAAGAGGG + Intergenic
978225937 4:106335087-106335109 CTCTGTTGATGGGAGGAAGATGG + Intronic
978493319 4:109332670-109332692 CTCTGCTAGTGGATGGAGCATGG + Intergenic
978654314 4:111048611-111048633 CTCTGCTTGAGGAGAGAAGAAGG + Intergenic
979426392 4:120572466-120572488 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
979799876 4:124895038-124895060 CTGTATTAGTGGAGGCAAAATGG + Intergenic
980709340 4:136543862-136543884 TTCTGAGAGAGGAGGGAAGACGG + Intergenic
981466091 4:145074306-145074328 CTCTTTTTGAGGAGGGCAGAGGG + Intronic
981618912 4:146671766-146671788 CTCTGTGACTGGAGAGAAGGAGG + Intergenic
982314253 4:154015419-154015441 CTCTGTAAGTGGAGAGGTGAGGG + Intergenic
984381509 4:178998240-178998262 CTCTAAAAGTGGAGGGAAGATGG - Intergenic
984584907 4:181552647-181552669 CTCAGTTACTGGGGGGAAAATGG + Intergenic
985156024 4:186987941-186987963 CTCTGCTAGGGCAGTGAAGAAGG - Intergenic
985216575 4:187659450-187659472 CTCTGTTGGTTCAAGGAAGAGGG - Intergenic
985525513 5:399487-399509 CTCTGTGACTGGAGGGCAAATGG - Intronic
985794256 5:1950236-1950258 CTCTCGGTGTGGAGGGAAGAGGG + Intergenic
986164764 5:5264050-5264072 CTCAGTTGGTAGAGGGGAGATGG - Intronic
986194639 5:5526939-5526961 CTCTGTTAGTGCAGTGCAGAAGG + Intergenic
986650578 5:9959523-9959545 CTCTGTTAAAGGAGGGAGCAGGG + Intergenic
987414407 5:17647946-17647968 GTCTGTTCGTGGATGGAAAAGGG - Intergenic
987585026 5:19843531-19843553 CTCTGTTAGAGCAGTGCAGAAGG + Intronic
987810418 5:22827458-22827480 CTCTGCTAGGGCAGTGAAGAAGG + Intronic
988679983 5:33475524-33475546 CTCATTTACTGGAGGGAAGGAGG - Intergenic
989361829 5:40610348-40610370 CTCTCTTATTGGAGGGAGAATGG + Intergenic
989412775 5:41139793-41139815 CACTGGCACTGGAGGGAAGAAGG - Intergenic
989726840 5:44597270-44597292 CTCTGCTAGGGCAGTGAAGAAGG - Intergenic
992409926 5:76495420-76495442 CTCAGTTCCTGGAGGGCAGAGGG + Intronic
993164967 5:84341032-84341054 CTATGTTGGAGGAGGGATGAGGG - Intronic
995246506 5:109941173-109941195 GTCTGATAGGGAAGGGAAGAAGG - Intergenic
995274691 5:110264825-110264847 CCCAGTCAGTGAAGGGAAGAGGG - Intergenic
995319994 5:110823713-110823735 GTCTGCCAGTGGAGGGAAGATGG - Intergenic
995703572 5:114961920-114961942 CTCTGCTAGGGCAGTGAAGAAGG - Intergenic
996011231 5:118483555-118483577 CTCTGCTAGGGCAGTGAAGAAGG - Intergenic
996266642 5:121549221-121549243 CTGAATTAGTGGAGGAAAGAAGG - Intergenic
996347788 5:122506073-122506095 CCCTGTTTATGGAGGGAAGATGG - Intergenic
997091551 5:130864469-130864491 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
997600578 5:135135761-135135783 TGCTGTCAGTGGAGGGAAGATGG - Intronic
997639207 5:135437586-135437608 CTGTTTCAGGGGAGGGAAGAGGG - Intergenic
999179081 5:149656172-149656194 CTCAGTAATTGAAGGGAAGAGGG - Intergenic
999919790 5:156305544-156305566 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1000245769 5:159447281-159447303 ATGTGTTTGTGGAGGAAAGAAGG + Intergenic
1000571817 5:162924191-162924213 GTGTGTTTGTGGAGGGAAGGAGG + Intergenic
1000610139 5:163365095-163365117 CTCTGCCAGTGAAGGGCAGAGGG - Intergenic
1001375405 5:171251779-171251801 CTCTGTGATTGGGTGGAAGATGG + Intronic
1001973706 5:175979206-175979228 CTCAGTCAGTAGAGGGGAGATGG + Intronic
1002243726 5:177864573-177864595 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1002411363 5:179079999-179080021 CTCTATAAGTGGAAGGAATATGG + Exonic
1002990092 6:2230406-2230428 CGCTGTTAGTGGAGGGCTTAGGG - Intronic
1003025739 6:2554085-2554107 CTCTGTGAGGGGTGGGGAGAAGG - Intergenic
1003117471 6:3292903-3292925 CTCTGTTGGTGAAGAGAAGCTGG - Intronic
1004353704 6:14913050-14913072 ATCTGTTAGTGGGCGGAAGCGGG - Intergenic
1004743448 6:18486508-18486530 ATGTGTTAGAAGAGGGAAGATGG + Intergenic
1005030063 6:21500181-21500203 CTCTGTTAGTGGGAAGAACAGGG + Intergenic
1005341193 6:24845340-24845362 ATCTTTTAGGGGAGGGATGAAGG + Intronic
1005628453 6:27685445-27685467 CTCTGTTAGTGTGGAGAAGCAGG + Intergenic
1005827327 6:29641882-29641904 CACTGTTAGTGAAGGGCAGAAGG - Intergenic
1005882155 6:30070065-30070087 CTCTGGGAGAGGAAGGAAGAGGG + Exonic
1005949731 6:30622905-30622927 CTCTGGTGGTGCAGGGATGATGG - Intronic
1006583120 6:35088005-35088027 CTCTGTTCTGTGAGGGAAGAAGG - Intronic
1009481008 6:64157828-64157850 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1009550788 6:65089106-65089128 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1009637133 6:66280694-66280716 CTCTGCTAGGGCAGTGAAGAAGG + Intergenic
1009699758 6:67161046-67161068 CTCTGGTAGGGGAGTGCAGAAGG + Intergenic
1010784030 6:79979030-79979052 CTGTGCTAGATGAGGGAAGATGG - Intergenic
1011041175 6:83032035-83032057 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1011088638 6:83570852-83570874 CTCTGTTAGGGCAGTGCAGAGGG + Intronic
1011236069 6:85218524-85218546 CTCTGTTTGTGGAAAGGAGAGGG + Intergenic
1011348994 6:86401879-86401901 CTCTGCTAGGGCAGTGAAGAGGG - Intergenic
1011488627 6:87868760-87868782 CTGGGTGAGAGGAGGGAAGAAGG - Intergenic
1011792735 6:90915720-90915742 CTCTGTTAGAGCAGTGCAGAAGG + Intergenic
1012026970 6:94008304-94008326 CACTGTTGGTGGATGGGAGAGGG - Intergenic
1012683232 6:102209711-102209733 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1012765598 6:103363284-103363306 CTCTGCTAGGGCAGTGAAGAAGG + Intergenic
1013084255 6:106842050-106842072 CTCTGCAAGTGTGGGGAAGAGGG - Intergenic
1013503022 6:110771189-110771211 CTCTGTTAGGGCAGTGCAGAAGG - Intronic
1013609084 6:111777568-111777590 CACAGTTAGGGGAGGGAGGAGGG - Intronic
1013932838 6:115555481-115555503 CTCTGGGAGATGAGGGAAGATGG - Intergenic
1014808998 6:125864413-125864435 CTCTCTGATTGGAGGGAAAATGG + Intronic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015293316 6:131562162-131562184 CTCTCTTAGGTGAGGAAAGAAGG + Intergenic
1015502045 6:133944898-133944920 CACTGTGATTGGTGGGAAGAAGG - Intergenic
1017712813 6:157185113-157185135 CTCTGTCAGTGGGGAGGAGAGGG - Intronic
1017763716 6:157590639-157590661 CTCTGTTAGGGCAGTGCAGAAGG + Intronic
1018466148 6:164047479-164047501 CTCTGTTAGGGTAGGGTGGAAGG + Intergenic
1019734465 7:2644013-2644035 CTCTGCAAGTGGAGAGCAGAGGG + Intronic
1019853941 7:3585693-3585715 GTTTGGTAGGGGAGGGAAGAAGG + Intronic
1020442271 7:8230967-8230989 ATCTCATAGTGGAGGGAAGGTGG + Intronic
1021400960 7:20209126-20209148 CTCTACTAGGGCAGGGAAGAAGG + Intronic
1022186262 7:27972413-27972435 CTCTTTTAGGGGAAGGAGGATGG + Intronic
1022489364 7:30804960-30804982 ATGTGTGAGTGGTGGGAAGAGGG + Intronic
1023770661 7:43553840-43553862 TTGTGCAAGTGGAGGGAAGAAGG - Intronic
1023796026 7:43792963-43792985 CACAGATAGTGGAGGGCAGAAGG + Intronic
1024544899 7:50508924-50508946 CTTTCTTGTTGGAGGGAAGAGGG - Intronic
1025038580 7:55619393-55619415 CTCTGCTAGGGCAGTGAAGAAGG + Intergenic
1026451777 7:70535799-70535821 GTCTTTTGGTGGAGGAAAGAAGG - Intronic
1027584792 7:80044682-80044704 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1028032439 7:85933036-85933058 CTCTGCTAGTGCAGAGCAGAAGG + Intergenic
1029939441 7:104464458-104464480 CTCTGCTAGGGCAGTGAAGAAGG - Intronic
1030787881 7:113684792-113684814 CTCAGTCAGTAGAGGGGAGATGG - Intergenic
1031254944 7:119435455-119435477 CTCTGTTAGGGAAGTGCAGAAGG - Intergenic
1031306211 7:120130725-120130747 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1031964640 7:128018851-128018873 CAATGTTAGTTGAGGGTAGAGGG - Intronic
1032502013 7:132406793-132406815 CTCTGTGAATGAAGGTAAGAAGG + Intronic
1032810747 7:135413953-135413975 TACTGTTAGTGGAAGGAGGATGG - Intronic
1033290592 7:140079489-140079511 CACTGGTTGTGGTGGGAAGAGGG + Intergenic
1033374179 7:140741518-140741540 CACAGCTAGTGGTGGGAAGAAGG - Intronic
1033790432 7:144786645-144786667 TTCTGATAGAGAAGGGAAGAGGG - Intronic
1034187580 7:149190804-149190826 CACTGTTAGTTAAGTGAAGAGGG - Intergenic
1034623096 7:152471479-152471501 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic
1034692691 7:153026796-153026818 CTCTGCCAGTGCAGGAAAGAAGG + Intergenic
1035866128 8:3084073-3084095 ATCTGTGAGTGGATGGGAGAAGG + Intronic
1038367485 8:26951046-26951068 GTCTGATAGTGGAAGGTAGAAGG + Intergenic
1038452062 8:27646180-27646202 AGATGTCAGTGGAGGGAAGATGG + Intronic
1038885170 8:31655430-31655452 TTCTGTTAGGGTAGGGAGGAGGG + Intronic
1040797290 8:51300040-51300062 CTCTGCTAGGGCAGGGCAGAGGG - Intergenic
1041368004 8:57129830-57129852 ATCTGTTTGTGAAAGGAAGATGG + Intergenic
1042761533 8:72276571-72276593 CTCTGTTAGGGCAGTGAAGAGGG + Intergenic
1042813561 8:72852980-72853002 CTCTTTTTCTGGAGGGGAGAGGG + Intronic
1043077022 8:75715440-75715462 CTCTGCCAGCGGAGGGCAGAGGG - Intergenic
1043262527 8:78220106-78220128 CTCTGCTAGGGCAGGGAAGAAGG - Intergenic
1043424310 8:80133445-80133467 ATCTGGTTTTGGAGGGAAGAAGG - Intronic
1044540406 8:93402736-93402758 CTCTGTTATTTAAAGGAAGAGGG + Intergenic
1045050473 8:98319899-98319921 CTCTGCTAGGGCAGTGAAGAAGG - Intergenic
1045398463 8:101785637-101785659 CTGGGTTAGTACAGGGAAGACGG + Intronic
1046801999 8:118438944-118438966 CACTGTTTGTGCAGGGAAAAGGG + Intronic
1047528445 8:125654114-125654136 CTCTGGTAGGGGAGTGAGGAAGG + Intergenic
1047864541 8:129007586-129007608 ATCTGATAGTGGAGGGTAGAAGG - Intergenic
1047983244 8:130205174-130205196 CTATGTGAGAGGAAGGAAGAAGG - Intronic
1050619501 9:7437896-7437918 CTCTCTTGGAGGAGTGAAGATGG + Intergenic
1051330407 9:16019361-16019383 CTCTGTTAGTGGATAGATGAGGG + Intronic
1051877252 9:21805688-21805710 CTCACTTAGTAGAGGGAATAAGG - Intronic
1052428636 9:28337889-28337911 CTCTGTTAGAGAAGTGCAGAAGG + Intronic
1055794088 9:79955423-79955445 CTCTGTTAGGGGAACGCAGAAGG + Intergenic
1056087071 9:83161060-83161082 CTCTGTCAGGGGAGTGCAGAAGG + Intergenic
1056516715 9:87359180-87359202 CTCTGCTTGAGGAGAGAAGAGGG + Intergenic
1056969269 9:91189019-91189041 CTCTGTTAGTTCAGGTGAGATGG - Intergenic
1057983089 9:99681813-99681835 CTCTGCTAGGGGAGTGCAGAGGG - Intergenic
1058164861 9:101607725-101607747 CTCTGTTAGTGTGGGGAACCAGG - Intronic
1062157869 9:135063769-135063791 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1186364036 X:8873111-8873133 CTCTGTTTGGGTAGGGATGATGG - Intergenic
1187068957 X:15868923-15868945 CTCTGTTAGTGGTTTGTAGACGG + Intergenic
1187214683 X:17264898-17264920 CTCTGCTAGGGGAGTGCAGAAGG + Intergenic
1189669733 X:43395138-43395160 CTCTGTTAGGGCAGTGCAGAAGG - Intergenic
1189917412 X:45869931-45869953 CCCTGTAAGTGGGGGGAGGAAGG + Intergenic
1190012419 X:46796675-46796697 ATCTGTGAGTGGTTGGAAGAGGG - Intergenic
1190320371 X:49176344-49176366 CAGTCTTAGTGGAGGAAAGAAGG - Intronic
1190487432 X:50941841-50941863 CTCTGCTGGTGGAGGACAGAGGG + Intergenic
1190630147 X:52378278-52378300 CACTGTTGGTGGGGGGAGGAGGG + Intergenic
1193471284 X:81907269-81907291 CTCTGCTAGTGCAGGGCAGGAGG - Intergenic
1193797677 X:85896475-85896497 AGCAGTTTGTGGAGGGAAGATGG + Intronic
1194467074 X:94246311-94246333 CTCTGCTAGGGGAGTGCAGAAGG + Intergenic
1194941521 X:100016422-100016444 CTCTGCTAGGGGAGTGCAGAAGG + Intergenic
1195274974 X:103273186-103273208 TACTGTTAGTGCAGGGGAGAGGG + Intergenic
1195460303 X:105116100-105116122 CCCTGCAAGTGGAGGGAAGCCGG + Intronic
1195525902 X:105889531-105889553 CTCTGTTAGGGCAGTGTAGAAGG - Intronic
1196368274 X:114947067-114947089 CTCTGCTAGTGCAGTGCAGAAGG - Intergenic
1196896706 X:120344232-120344254 TTCTGGGAGTGGAGCGAAGATGG + Intergenic
1198013965 X:132589752-132589774 CTTTGCTAGGGGAGAGAAGAAGG + Intergenic
1198608712 X:138373255-138373277 CTCTGCTAGGGCAGTGAAGAAGG + Intergenic
1198649262 X:138843227-138843249 CTCTGTAGGTAGATGGAAGAAGG - Intronic
1199147077 X:144380911-144380933 CTCTGTTAGGGCAGTGCAGAAGG + Intergenic