ID: 1074763943

View in Genome Browser
Species Human (GRCh38)
Location 10:116686880-116686902
Sequence CAGTGTGGGAAGAGGGATGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 730
Summary {0: 1, 1: 0, 2: 6, 3: 70, 4: 653}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074763943_1074763955 29 Left 1074763943 10:116686880-116686902 CCCTCATCCCTCTTCCCACACTG 0: 1
1: 0
2: 6
3: 70
4: 653
Right 1074763955 10:116686932-116686954 CTACCCCTGAAATTCTGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074763943 Original CRISPR CAGTGTGGGAAGAGGGATGA GGG (reversed) Intronic
900204721 1:1427076-1427098 CAGGGCGGGAAGAGGGAGGGGGG - Intronic
900324885 1:2103859-2103881 CAGTGGGAGGAGAGGGGTGAAGG + Intronic
900806941 1:4773766-4773788 CCGTGTGGGTAGAGGGCAGAGGG + Intronic
900871662 1:5308599-5308621 CAATGTGGGAAGAGGGAGAGAGG - Intergenic
901010978 1:6201957-6201979 GGGTGTGGGGTGAGGGATGAGGG - Intronic
901855040 1:12039146-12039168 CAGGGAGGGAGGAGGGATGTGGG + Intergenic
901862514 1:12083929-12083951 GTGTGTGGGAGGGGGGATGACGG + Intronic
902112964 1:14098600-14098622 CAGTCTGGGCAGAGGGATGCTGG - Intergenic
902987234 1:20162301-20162323 CAATGGAGGAAGAGGGGTGAGGG - Intronic
903564103 1:24251650-24251672 CATTGTGGGAAGCTGGGTGAAGG - Intergenic
903834598 1:26195179-26195201 TGGTGGGAGAAGAGGGATGAGGG - Intronic
904306559 1:29593905-29593927 GTGTGTGGGAAGGGGGAAGAGGG + Intergenic
904601087 1:31672945-31672967 GAGTGTGGGAGGAGGGAAGACGG - Intronic
905203491 1:36329574-36329596 CACTGTGGGGGAAGGGATGAGGG - Intergenic
905265065 1:36746686-36746708 GACTGTGGGGAGAGGGGTGAGGG + Intergenic
905774124 1:40657291-40657313 CAGTGGGGAAAGAGGCAGGATGG + Intronic
906095030 1:43217104-43217126 GAGTGTGTGCAGAGGGATGAGGG + Intronic
906306904 1:44725220-44725242 GAGTGTGGGACGAGGGAAGCCGG + Intronic
906610933 1:47202003-47202025 CATTGTGGGGAGAGGGAGCATGG + Intergenic
906661981 1:47589546-47589568 CGGTGAGGAAGGAGGGATGATGG - Intergenic
906835899 1:49083274-49083296 CAGTGTAGGAAGAGAAATGTGGG - Intronic
907442203 1:54486084-54486106 CTGTGTGGGAATAGGGATTAAGG - Intergenic
907486028 1:54778725-54778747 CAGTGTGGGAGCAGAGATGAGGG + Intergenic
907494637 1:54835786-54835808 CAGCCTGAGAAGAGGGATGAAGG + Intronic
907975364 1:59426361-59426383 CAGGGTGGGAAGGGGAGTGAAGG + Intronic
908328745 1:63049600-63049622 TCCTGTGGGAAGAGGGATGTGGG + Intergenic
908344952 1:63222608-63222630 TAGAGAGGGAAAAGGGATGATGG - Intergenic
908565434 1:65351017-65351039 CAGTGTGGACATAGGGATTAGGG - Intronic
909436671 1:75650197-75650219 GAGGCTGGGAAGAGGGCTGAGGG - Intergenic
909481174 1:76130183-76130205 CTGTGTGGGAACAGGGACTATGG - Intronic
909647568 1:77934621-77934643 CAGAGTCCGAAGAGGGAAGAAGG - Intronic
909984149 1:82140018-82140040 AACTGTGGGAAGAGGGCTGGGGG + Intergenic
910655432 1:89613719-89613741 AAAGGTGGGAAGAGGGGTGAGGG + Intergenic
910894435 1:92053276-92053298 CCCTGTGGGAAGATGGAGGAGGG + Intronic
911303136 1:96200164-96200186 CAGTGTGGGATGAGGCACCAGGG + Intergenic
912738659 1:112173674-112173696 CAGAGTGGGAAAGGGGGTGAGGG - Intergenic
912997645 1:114547273-114547295 GAGTGGGGAAAGAGGGCTGAGGG + Intergenic
913542116 1:119831399-119831421 GAGGGTGGGAAGTGGGAGGAGGG + Intergenic
915091376 1:153428659-153428681 ATGTGTGGGCAGAGGGAGGAGGG + Intergenic
915103367 1:153516271-153516293 CAGGGTGGGAGGAGGTAGGATGG - Intergenic
915278290 1:154804888-154804910 CAGTGTGTGCAGAGGGTTGGAGG - Intronic
915314327 1:155019444-155019466 CTGAGTGGGAACAGAGATGACGG - Intronic
915535155 1:156530925-156530947 CAGTGTGTGAAGTGGGGAGAGGG + Intronic
915703357 1:157819370-157819392 CTATGGGGGAAGAGAGATGAAGG + Intronic
916028399 1:160855375-160855397 CAGTGTGGGAAGGAGGAAGATGG + Intronic
916847869 1:168671601-168671623 ATGTGTGGCAAGAGGGAAGAGGG + Intergenic
917002040 1:170370986-170371008 CAGGGTGGGGGGAGGGAGGAGGG - Intergenic
917115098 1:171594982-171595004 GATTGGGGGAAGAGGTATGATGG + Intergenic
917440831 1:175067371-175067393 AAGTGTGAGACGATGGATGAAGG + Intergenic
917568402 1:176235895-176235917 CAGTATGGGAAGAGGGGTGATGG + Intergenic
917605231 1:176621424-176621446 CAGGGTGCCAAGGGGGATGATGG - Intronic
917846314 1:179023369-179023391 CAGTTTGGGAACAAGGAAGAAGG + Intergenic
919150404 1:193690030-193690052 CAGGGTGGGAAGGGGGTGGATGG + Intergenic
919742325 1:200988591-200988613 AAGTGTCGGGGGAGGGATGATGG + Intronic
919770020 1:201152132-201152154 GAATGCGGGGAGAGGGATGAGGG + Intronic
920092461 1:203464318-203464340 AAGTGTGGGCAGAAGGAGGAAGG - Intergenic
920309660 1:205041616-205041638 CAGTGTGGGCAGGGGAAGGAAGG + Intergenic
920910236 1:210209735-210209757 CAGTCTAGGGAGAGTGATGAAGG - Intergenic
920916848 1:210264624-210264646 CAGTGTGGGGATAGGGGTGAGGG - Intergenic
921790030 1:219279206-219279228 CTATGTGGGAAGAGGAATGTGGG + Intergenic
922223401 1:223625989-223626011 CAGTGTGGGACTAGGGGTGTAGG + Intronic
922318738 1:224465679-224465701 CATTGAGGGAGGAGGGGTGAAGG - Intronic
922949022 1:229542674-229542696 CAGAGTGGGAAGAGACAGGATGG + Intronic
922979907 1:229816877-229816899 CAGAGTGGGAAGAGGAGAGAAGG - Intergenic
923010304 1:230083163-230083185 CAGAGTGGGGAGCAGGATGATGG + Intronic
923265086 1:232306503-232306525 GAGTGTGGGAAGGGAGAGGAAGG - Intergenic
923742109 1:236664406-236664428 CACTGAGGGAGGAGGGAAGATGG - Intergenic
923904665 1:238370548-238370570 CAGTATGGGAAGAGAGTAGAGGG - Intergenic
924845620 1:247767177-247767199 AAGGGTGGGAAGGGGGTTGAGGG - Intergenic
1062785075 10:257799-257821 CTGTGTGGGATGTGGGATGTCGG + Intergenic
1063312145 10:4963460-4963482 CAGTGTGTGAAGCTGAATGATGG + Exonic
1063315741 10:5003798-5003820 CAGTGTGTGAAGCTGAATGATGG - Exonic
1063901677 10:10739508-10739530 CATTATGGGAAGCTGGATGATGG - Intergenic
1063914024 10:10862902-10862924 CTGTGTGGGAATAGGAATAAGGG + Intergenic
1064240203 10:13620561-13620583 CAGGCTGGGAACAGGCATGAAGG - Intronic
1064502481 10:15989251-15989273 AGGTGTGGGAAGAGAGAAGAGGG + Intergenic
1065198759 10:23293475-23293497 CAGTGTGGGCAGATGGCAGAAGG - Intronic
1065487698 10:26250490-26250512 CTTTGTGGGATGAGGGAAGAAGG + Intronic
1067856601 10:49799057-49799079 CAGTGACAGAAGAGGGAGGAGGG - Intergenic
1067924772 10:50497040-50497062 CAGTGTTGGAAGAAGGGTGGAGG - Intronic
1067965584 10:50909175-50909197 CAGTGTGGTAAGTGCTATGATGG - Intergenic
1068017573 10:51536791-51536813 CAGGGTGGGGGGAGGGGTGAGGG - Intronic
1068884381 10:62083500-62083522 GAGTGTGGGAAGGAGGAGGAGGG - Intronic
1069622674 10:69847493-69847515 CAGAGTAGGGAGAGAGATGAGGG - Intronic
1069635397 10:69921879-69921901 CAGGGTGAGAAGGGGGCTGAAGG + Exonic
1070271016 10:74955024-74955046 CAGTGGTGGTAGAGGGGTGAGGG - Intronic
1071264497 10:83952873-83952895 AAGAGTGAGAAGAGGGAAGAGGG + Intergenic
1072009370 10:91290241-91290263 CAGAGTGGGAAGCAGGAGGAGGG + Intergenic
1072783490 10:98265856-98265878 CAGTGTGGGTGGAGGGAAAAGGG - Intronic
1072994202 10:100229054-100229076 ATGTGTGAGAAGAGGGCTGAAGG - Intronic
1073441287 10:103554178-103554200 CAGAGGGGGAAGAGGGAGGCTGG - Intronic
1074165763 10:110872349-110872371 CAGAGGGGGAGGAGGGCTGAGGG - Intronic
1074270406 10:111947915-111947937 GAGTGTGGGGAGTGGGAGGAGGG + Intergenic
1074544152 10:114389354-114389376 CAGGGTGGGAAGTGGGGAGAGGG + Intronic
1074699930 10:116083890-116083912 CAGAGTGGCAGGAGGGATGGAGG - Intronic
1074763898 10:116686718-116686740 CAGTGTGGGAAGAGGGGACAAGG - Intronic
1074763914 10:116686784-116686806 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763934 10:116686847-116686869 TGGTGTGGGAAGAGGGATGAGGG - Intronic
1074763943 10:116686880-116686902 CAGTGTGGGAAGAGGGATGAGGG - Intronic
1074763949 10:116686912-116686934 TAGTGTGGGTAGAGAGATGGGGG - Intronic
1074814673 10:117135008-117135030 CGGTGAAGGAAGAGGGAAGAAGG + Intronic
1075966167 10:126613646-126613668 CAGTGATTGAAGAGGGATAAAGG - Intronic
1076440327 10:130477022-130477044 CTACCTGGGAAGAGGGATGATGG - Intergenic
1077163246 11:1123089-1123111 GAGAGAGGGAAGAGGGAGGAAGG - Intergenic
1077908789 11:6557033-6557055 TAGTGTGGGTGGAGGGGTGAAGG - Exonic
1078042596 11:7882597-7882619 AAGTGTGGGAAGAGAGGTTAGGG + Intergenic
1078187204 11:9062158-9062180 AGTTGGGGGAAGAGGGATGAGGG - Intronic
1078478474 11:11655556-11655578 CAGTAGCTGAAGAGGGATGAAGG + Intergenic
1078604306 11:12761638-12761660 GAGGGTGGGCAGAGGGATGATGG + Intronic
1079010330 11:16822775-16822797 CACTGGGGGAAGAGGGATAGGGG + Intronic
1079029568 11:16976408-16976430 GAGTGAGGGAAGAGGGGTGCTGG - Intronic
1079158323 11:17969520-17969542 GAGTGTGGGTGGAGGGGTGAGGG + Intronic
1080774125 11:35370021-35370043 CAGTGTGGGCAAAGGCATGAAGG + Intronic
1080922323 11:36721454-36721476 CAGTGAGAGAAGGGGGATAAGGG - Intergenic
1081340760 11:41924424-41924446 CATTGTGGGGAGAGGGAGGAAGG - Intergenic
1081631436 11:44692627-44692649 CAGGGTGGGAAGGGGGAAGCAGG + Intergenic
1081674402 11:44960204-44960226 CAGTGTGGGAAGAGAAAAGGTGG + Intergenic
1081795447 11:45816078-45816100 CAGGGTGGGATGTGGGGTGAAGG + Intergenic
1081960227 11:47130635-47130657 CAGTGTGGGGGAAGGGAAGAAGG - Intronic
1082182132 11:49132956-49132978 GAGTGTGGGCAGAGTGATGTAGG - Intergenic
1082767418 11:57180555-57180577 CAGTGTGTGGAAAGGGATGCTGG + Intergenic
1082840806 11:57688319-57688341 CACTATGGGAACATGGATGAGGG - Intronic
1083397662 11:62402446-62402468 CGCTGTGGGCAGAGGGAAGAGGG - Intergenic
1083610687 11:64002837-64002859 TGGGGTGGGAAGAGGGAAGAGGG - Intronic
1083627523 11:64079181-64079203 GTGTGTGGGATGAGGGAAGAGGG + Intronic
1083884912 11:65568310-65568332 CAGTGGGAGAAGAGGGATGCAGG + Intergenic
1084941466 11:72615488-72615510 CAGAGTGGGTAGAGGGAGGGAGG + Intronic
1084941476 11:72615519-72615541 GAGTGTGGGGAGGGGGAGGATGG + Intronic
1084951222 11:72666652-72666674 CAATGTGAGCACAGGGATGAGGG - Intronic
1084958973 11:72706273-72706295 CAGTCTGGGTAGAAAGATGAAGG - Intronic
1085238611 11:75033741-75033763 CAGTGTGGGAAGAGGTCAGGAGG + Intergenic
1085317205 11:75552885-75552907 CAGTGTGGGATCAGGGGTCAGGG - Intergenic
1085549233 11:77352194-77352216 TAGAGTGGGAATAGGCATGAAGG - Intronic
1086289334 11:85289354-85289376 AAGTGTGGGAAGGGGGATCTGGG - Intronic
1086407141 11:86508120-86508142 CAGTGTGGGGGTGGGGATGAGGG - Intronic
1086929925 11:92681835-92681857 CAGTGTGGGAGGGAGGAGGAGGG + Intronic
1087434143 11:98091206-98091228 CTGTGTGTGTAGGGGGATGAAGG + Intergenic
1087439885 11:98170018-98170040 CAGTGGGGTGAGAGGGATGGGGG + Intergenic
1087726016 11:101717868-101717890 CATTGTGGGAATACAGATGAGGG + Intronic
1088017503 11:105078481-105078503 CAGTGTGGGAAGAAGCACAAAGG + Intronic
1088020076 11:105108458-105108480 CAGTGTGGGAAGAAGCACAAAGG + Intergenic
1088180120 11:107099733-107099755 AAGGGTGGGAAGGGGGGTGAGGG + Intergenic
1088236471 11:107730066-107730088 CAGACTTGGAAGAGGGATGGTGG - Intergenic
1088463932 11:110112938-110112960 CAGTGGGGCAGGAGAGATGACGG - Intronic
1088892397 11:114055374-114055396 GGGTGGGGGATGAGGGATGATGG + Intergenic
1089457500 11:118634131-118634153 GAGGGTGGGAAGGGGGACGAGGG - Intronic
1089627306 11:119759589-119759611 CAGGGTTGGAGGAGGGTTGAGGG + Intergenic
1090208527 11:124899027-124899049 CAGGATGGGAAGGGGGAGGAAGG - Intergenic
1091226475 11:133959366-133959388 CAGAGTGGAACAAGGGATGAAGG + Intergenic
1091681849 12:2533050-2533072 CAAAGAGGGAGGAGGGATGAAGG + Intronic
1092108605 12:5943511-5943533 AAGGGTGGGAGGAGGGATAAGGG + Intronic
1093059928 12:14591164-14591186 CAGTCTGTGATGAAGGATGAAGG - Intergenic
1093226335 12:16488352-16488374 CAGAGAGGGGAGAGAGATGAGGG - Intronic
1093284465 12:17241415-17241437 AAGGGTGGGAGGGGGGATGAGGG - Intergenic
1093436437 12:19140151-19140173 CCGTCTGGGGAGTGGGATGATGG + Intronic
1093958826 12:25251052-25251074 CGGTGTGGGAAGAGGGAAGAGGG + Intergenic
1094138193 12:27151670-27151692 AAATGTGGGAAGAGGAAGGAGGG - Intergenic
1094157670 12:27354424-27354446 GAGGGTGGGAAGAAGGGTGAGGG + Intronic
1095688566 12:45063027-45063049 CAGGGTGGGAAGTGGGAGGGTGG - Intergenic
1095716474 12:45351564-45351586 CAGAGTGGGAAGTGAGTTGAGGG + Intronic
1096828036 12:54294405-54294427 CTGTGTGGGAAGAGGGCCTAGGG + Intronic
1096868728 12:54580066-54580088 TGCTGTGGGAAGAGAGATGAGGG - Exonic
1096910812 12:54981973-54981995 CAGTGTGGGAGGAGAGAAGAAGG + Intronic
1097235791 12:57538574-57538596 GAGTGGGGGAATGGGGATGAGGG + Intronic
1097244452 12:57599461-57599483 GGGTGAGGGATGAGGGATGAGGG + Intronic
1097349734 12:58535755-58535777 CAGTCTGGAAAGAGAGAGGAAGG - Intergenic
1098394401 12:70002992-70003014 CGGTGTGGGAAGAGGGCCAAGGG + Intergenic
1098620630 12:72593656-72593678 CAGGGTGGGAGGAGGGGGGAGGG - Intronic
1099872139 12:88362684-88362706 CAGGGTGGGAGGAGGTGTGAAGG - Intergenic
1100201064 12:92298300-92298322 CTCAGAGGGAAGAGGGATGAGGG + Intergenic
1101088956 12:101265245-101265267 TGTTGTGGGATGAGGGATGAGGG - Intergenic
1101545285 12:105706655-105706677 CAGATGGGGAGGAGGGATGAGGG - Intergenic
1101662140 12:106775003-106775025 CAGTGGGGGTAGTGGGATGCAGG - Intronic
1101835137 12:108289658-108289680 AAATGTGGGAAGAGGGGAGATGG + Exonic
1101968149 12:109294760-109294782 CAGTGTGGGCAGGGGGTTGGGGG - Intronic
1102926485 12:116830132-116830154 CATTAGGGGAAGAGGAATGAAGG - Intronic
1103366967 12:120390568-120390590 AAGGGAGGGAAGAGGGAAGAAGG + Intergenic
1103419856 12:120771673-120771695 CAGTGGAGGAAGAGAGCTGAAGG - Intronic
1103486719 12:121288129-121288151 CAGTGGGGGAAGAGGAAGGAAGG - Intronic
1104094987 12:125548786-125548808 CTGTGTGGGAAATGGGCTGAGGG + Intronic
1104300362 12:127559438-127559460 CTGTGTGGGGAGTGGGAGGAGGG + Intergenic
1104408403 12:128537886-128537908 CATTGGGGGAAGCTGGATGATGG + Intronic
1104595939 12:130120035-130120057 CAGTGTGTGAAGATGCATGTGGG - Intergenic
1104628589 12:130380133-130380155 TTGGGTGGGAAGTGGGATGAGGG - Intergenic
1104691145 12:130827248-130827270 TAGTGTAGGAAGAATGATGATGG - Exonic
1104757661 12:131279154-131279176 CAGTGTGGGGAGAGGGAGAGGGG + Intergenic
1104966474 12:132510713-132510735 CAGTGGGGGGAGAGGGAGCATGG - Intronic
1105230783 13:18493768-18493790 CAGTGTGGGGGGATGGGTGAGGG - Intergenic
1105428116 13:20313177-20313199 CTGAGTGGGATGAGGGATGAAGG + Intergenic
1105597735 13:21855321-21855343 AAGGGTGGGAGGGGGGATGAGGG - Intergenic
1105870595 13:24502783-24502805 CAGTGTGGGAAGCTGTATAAGGG + Intronic
1105917950 13:24934289-24934311 CAGTGTGGGAAGCTGTATAAGGG - Intergenic
1106326496 13:28695383-28695405 CAGTGTGAGAAATGAGATGAGGG - Intergenic
1107564632 13:41589577-41589599 CTTTGTGGGGAGAGGGAGGAAGG - Intronic
1108364608 13:49697273-49697295 ATGTGTGGGAAAAGGGATGTGGG - Intergenic
1108434721 13:50390371-50390393 CAGTCTGGCAAGAGTGATGAAGG - Intronic
1108536420 13:51385202-51385224 CAGAGTGGGAAGGGGTATGAGGG - Intronic
1109140250 13:58705694-58705716 CAGGAAGGGAAGAGAGATGAAGG - Intergenic
1109407622 13:61921949-61921971 CAGGGTGGGGAGAGGAAAGAAGG - Intergenic
1109514069 13:63418039-63418061 CAGGGTGGGGAGAGGGGGGAGGG + Intergenic
1109520546 13:63505113-63505135 TAATGTGGAAAGAGAGATGAGGG + Intergenic
1110696880 13:78501468-78501490 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1110696893 13:78501546-78501568 CAGTCTGGGTAGATGGAAGAAGG - Intergenic
1111000750 13:82177196-82177218 GGGTGTGGGAATGGGGATGAGGG + Intergenic
1112057330 13:95702232-95702254 CAGACTGGGAAGAGGCAGGAGGG - Intronic
1112528763 13:100180442-100180464 CATTGTGGGAAGAGGAATCTTGG - Intronic
1112621992 13:101062544-101062566 CAGAGAGGGAAGTGGGATGCAGG - Intronic
1113865277 13:113517862-113517884 GAGTGTGGGTGGAGGGAAGAGGG + Intronic
1114257129 14:21012645-21012667 CAGGATGGGAAAAGGGATGAGGG + Intergenic
1114287946 14:21262985-21263007 CAGTGTGGGGAAGGGGATGAGGG + Intronic
1114515618 14:23298007-23298029 CAGTGGGGGAAGAGGGAGGGAGG + Exonic
1115422533 14:33213137-33213159 CAGTGAGTGAAGAGGCCTGATGG - Intronic
1115447281 14:33505816-33505838 CAGCCTGGGAAGAGGGGAGATGG - Intronic
1116402160 14:44521243-44521265 CAGTGTGGGAAGAGTGACTAGGG + Intergenic
1117762149 14:59040514-59040536 CAGACTGGGAAGAAAGATGAAGG + Intergenic
1117938112 14:60930341-60930363 CATTGTGGGATGAGGTATGAGGG - Intronic
1119326525 14:73762795-73762817 CAGTTTGTAAAGAGGGTTGAGGG - Intronic
1119478871 14:74947501-74947523 GAGTGTGGGAGGAGGGATTCTGG - Intronic
1120452203 14:84682693-84682715 CAGTGTGGAAGGTGGGAGGAGGG - Intergenic
1120602108 14:86523633-86523655 AAGTGAGGAAAGAGGGAGGAGGG - Intergenic
1121489128 14:94345535-94345557 CATGGTGGGAAGAGGGAAGAAGG - Intergenic
1121760638 14:96441898-96441920 CAGTGGGGACAGAGGGGTGATGG - Intronic
1121827825 14:97025296-97025318 CAGGGTTTGAAGAGGGAAGATGG - Intergenic
1122144263 14:99679934-99679956 CAGTGGGGGAGGAGGGGCGAGGG - Exonic
1122389892 14:101373082-101373104 CGGTGTGGGAAGAGGGTTCCAGG + Intergenic
1122784071 14:104155852-104155874 CCCTGTGGGAAGAGGGTGGAGGG + Intronic
1123039130 14:105483246-105483268 AGGTGTGGAAAGAGGGAAGAAGG - Intergenic
1124010023 15:25830643-25830665 CAGTGAGGGAAGACGGAAGGGGG - Intronic
1124079427 15:26477651-26477673 AAGTGTGGGCAGAGGGGTGCAGG - Intergenic
1125501630 15:40243281-40243303 CAGGGCGGGAAGAGGCAGGATGG + Intronic
1126759947 15:51960888-51960910 GAGTGTGGGGAGAGGGAAGGGGG + Intronic
1126800436 15:52293197-52293219 CCCTGTGGGAACAGGGAAGAGGG - Intronic
1127775659 15:62262339-62262361 CACTGTGGGAGGAGGTTTGAGGG + Intergenic
1127907576 15:63387646-63387668 CAGAGAGGGAAGGGGGAGGAAGG + Intergenic
1128224720 15:65993819-65993841 CATGGTGGGAAGGGGAATGATGG - Intronic
1128675935 15:69608409-69608431 CTGTGTGGGTAGAGGAGTGAAGG + Intergenic
1128737708 15:70062663-70062685 CAGAGTGGGAGGGGGGATGGGGG - Intronic
1129004026 15:72357340-72357362 CTGTTTGGGAAGAGGAAGGAAGG - Intronic
1129183909 15:73894239-73894261 CAGTGTGGGCTGCGGGAGGATGG - Intergenic
1129185929 15:73906469-73906491 CAGTTTGGAAAGAAGGATGAGGG + Intergenic
1129674073 15:77622915-77622937 CAGTGTGGGCAGAGGGTGGCCGG - Intronic
1130556265 15:84924511-84924533 GAGTGTGGGGAAAGGGAGGAGGG - Intronic
1130667259 15:85880184-85880206 CAGGGTGGAAAGAGAGATCACGG - Intergenic
1131177459 15:90219113-90219135 CAGTGAGGGGCGAGTGATGATGG + Intronic
1132407675 15:101553957-101553979 CATTGTGGGAAGTGGAATCATGG - Intergenic
1133444789 16:5850864-5850886 CAGCGTGGGAGAAGTGATGAAGG + Intergenic
1133624989 16:7562729-7562751 CAGTGGGGGAAGGAGGAGGAAGG + Intronic
1134414295 16:14030326-14030348 CAGTGTGGTTAGAGGGCAGAGGG - Intergenic
1134446920 16:14337963-14337985 TTGTGTGGGAAGAGGGGTGGCGG - Intergenic
1134506458 16:14811483-14811505 CAGTGTGGGAGTAGGGTTCACGG + Intronic
1134566522 16:15256700-15256722 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1134574097 16:15317282-15317304 CAGTGTGGGAGTAGGGTTCACGG - Intergenic
1134735974 16:16499999-16500021 AAGTGAGGGAAGGAGGATGATGG + Intergenic
1134931550 16:18212160-18212182 AAGTGAGGGAAGGAGGATGATGG - Intergenic
1134939116 16:18272813-18272835 CAGTGTGGGAGTAGGGTTCACGG - Intergenic
1135434825 16:22419922-22419944 CAGTGTGGGATGGAGGAGGAGGG - Intronic
1135671141 16:24376623-24376645 CATGGTGGGGAGAGGGAAGAAGG - Intergenic
1136111587 16:28066832-28066854 CAGTGTGGGGACAGGCATGGTGG + Intergenic
1136235098 16:28908835-28908857 CAGTCTGGGAGGAGGGTTCAAGG - Intronic
1136537545 16:30909156-30909178 GAATGTGGCAAGGGGGATGAAGG - Intergenic
1137430202 16:48412401-48412423 CAAGGTGGGAAGAGGGCTGAAGG - Intronic
1138341106 16:56289605-56289627 CGGTGTGGGGAGAGGAAGGATGG + Intronic
1138399148 16:56731279-56731301 CAGTTTGGGGAGAGTAATGAAGG - Intronic
1138598378 16:58041418-58041440 CAGTGTGGGGAGATCGAGGAGGG + Intronic
1138832754 16:60395031-60395053 CAGGGTGGGCAGAGAGATGGTGG - Intergenic
1139110160 16:63880784-63880806 CAGTATGCTAAGAGGTATGAAGG + Intergenic
1139672119 16:68499087-68499109 CAGTAGGGGAAGAGGGAGGGAGG - Intergenic
1140232822 16:73131983-73132005 CTGTGATGCAAGAGGGATGAGGG + Intronic
1140586193 16:76295089-76295111 CAGTGTGGTAAGTGCAATGAGGG + Intronic
1140942211 16:79732828-79732850 CAATGTTGGTAGAGGGGTGAGGG - Intergenic
1141116112 16:81311272-81311294 AAGTGTGGGAAGAAGGATTCAGG - Intergenic
1141163913 16:81647816-81647838 CAGGGTGGCCACAGGGATGAGGG - Intronic
1142488955 17:265558-265580 AAGGGAGGGAAGAGGGAAGAGGG - Intronic
1142739928 17:1925941-1925963 CCCTGTAGGAAGAAGGATGATGG + Intergenic
1142781099 17:2181912-2181934 GAGAGAGGGAGGAGGGATGAAGG + Intronic
1142950988 17:3479923-3479945 CATTGTGGGAAGTGGGGAGAGGG + Intronic
1142958270 17:3535525-3535547 GAGTCTGGGAGGAGGGAGGAGGG - Intronic
1143153569 17:4822001-4822023 CATTATTGGAAGGGGGATGAGGG + Intronic
1143363209 17:6388056-6388078 CAGAGTGAGAAGGGGGATGTGGG + Intergenic
1143520494 17:7441602-7441624 CAGGGTGGGAAGGGGGAGAATGG + Intronic
1144182028 17:12761491-12761513 CATTGTAGCAAGAGGGAAGAAGG + Intronic
1144877633 17:18410791-18410813 CAGTGTGGGAGAAGAGTTGAGGG - Intergenic
1145154597 17:20533612-20533634 CAGTGTGGGAGAAGAGTTGAGGG + Intergenic
1145987603 17:29057639-29057661 CAGGGTGGGTGGAGGGGTGAGGG + Intergenic
1146828736 17:36047837-36047859 CAGTGTAGGAAGAGGGAGATGGG - Intergenic
1146918586 17:36694636-36694658 CAGTCTGGGAGGAGGGAACAGGG - Intergenic
1147257892 17:39192896-39192918 AAGTGGGGAAAGAGGCATGAAGG + Intronic
1147540329 17:41351927-41351949 GGGTGTGGGTAGAGTGATGAAGG + Intergenic
1147965527 17:44192491-44192513 CAGTCTGGGGAGTGGGCTGAAGG - Exonic
1148182951 17:45620216-45620238 CAGAAGGGGAAGAGGGATGCAGG - Intergenic
1148682227 17:49481043-49481065 CAGAGTGGGCAGAGGGGTGAAGG + Intergenic
1148887822 17:50786463-50786485 CAGGGTAGGAGGAGGGAGGATGG + Intergenic
1148987130 17:51632748-51632770 CAGTGTGGAAAGAAAGATGGAGG - Intronic
1149547630 17:57515978-57516000 CATTGTGGGAAGCTGGATGAAGG - Intronic
1149650358 17:58272665-58272687 TAGAGTGGGAAGGGGGGTGATGG + Intronic
1150483517 17:65528517-65528539 CAGGGTGGGAACAGGGCCGAGGG - Intergenic
1150548562 17:66188355-66188377 CATTGTGGCAAGAGGGAAGTGGG - Intronic
1150859864 17:68790380-68790402 TAGGGTGGGGAGAGGCATGAGGG + Intergenic
1151398003 17:73837355-73837377 TGGAGTGGGAAGAGGGAGGAGGG + Intergenic
1151579760 17:74971468-74971490 CAGGGTGGGGAAAGGGGTGAGGG + Intronic
1151615363 17:75206673-75206695 CAGGGTAGGTAGAGGGATTATGG + Intronic
1151930383 17:77228282-77228304 CAGTGTGGGAAGAGGCTGGACGG + Intergenic
1152181127 17:78822455-78822477 CAATCTGGGAAGAGGGGTGGGGG + Intronic
1152261535 17:79269898-79269920 CAGTGTGGGCAGGTGGATAAGGG - Intronic
1152607775 17:81301681-81301703 CCGTCTGGGAAGAGGGATGGAGG + Intergenic
1152688306 17:81705767-81705789 CAGTGGGGGAAAGGGGCTGAGGG - Intronic
1153275927 18:3367809-3367831 CAATGTGGGAAGCAGGGTGATGG + Intergenic
1154240072 18:12645370-12645392 TAGGGTGGGAAGATAGATGATGG - Intronic
1154522618 18:15246089-15246111 CAGTGTGGGGGGATGGGTGAGGG + Intergenic
1155560746 18:27073548-27073570 CAGTGTGACCAGAGGGAAGATGG + Intronic
1156375716 18:36513700-36513722 AAGAGGGGAAAGAGGGATGAAGG - Intronic
1156503010 18:37571488-37571510 CAGTGTGAGAGGCGGAATGAAGG + Intergenic
1156575825 18:38313932-38313954 CAGGGTGGGAGGAGGGGTGATGG - Intergenic
1156729480 18:40173983-40174005 CAGTTTGGAAAGAGGGGGGAAGG - Intergenic
1158875266 18:61728141-61728163 CAGGGCGGGAGGAGGGAGGAGGG - Intergenic
1160281407 18:77494166-77494188 AAGTGAGTGAAGAAGGATGATGG + Intergenic
1160526261 18:79540209-79540231 CACTGTGGACAGCGGGATGAGGG + Intergenic
1160820889 19:1057238-1057260 CAGGGTGGGAACAGGGCTGAGGG + Intronic
1160872116 19:1282331-1282353 GAGAGTGGGAAGGGGGAGGAGGG + Intergenic
1160937955 19:1606186-1606208 CGGTGTGGGCAGAAGGAAGAGGG + Intergenic
1161286451 19:3471004-3471026 CAGAGTGAGGAGAGGGATGGAGG + Intergenic
1161625608 19:5324834-5324856 CAGTGTGAGGATGGGGATGATGG - Intronic
1161635007 19:5382706-5382728 CAGTGAGGAAAGAGAGAGGAAGG - Intergenic
1161919783 19:7257446-7257468 CGGGGTGGGAGGAGGGAGGAGGG + Intronic
1162561666 19:11421103-11421125 CAGTATGGGTGGGGGGATGAAGG - Intronic
1163098428 19:15078263-15078285 CATTGAGGGAAGAGGTATGTGGG - Intergenic
1163801443 19:19368155-19368177 CAGTGGGGGCAGAAGGATGATGG - Intergenic
1164696389 19:30247574-30247596 CACTTTGGGAAGTGGGAAGATGG + Intronic
1164797040 19:31041666-31041688 CAGTTTGGGTGGAGGGATGGAGG - Intergenic
1165319547 19:35076848-35076870 CAGTGTGGGAAGGGGTGTGCAGG - Intergenic
1165346221 19:35250055-35250077 CAGGCTGGGAAGAGGGATGGCGG + Intronic
1165554300 19:36616901-36616923 CAGGGTGGACAGAGGGATGGAGG + Intronic
1165790705 19:38490039-38490061 CCGTGTGGGAGGAGAGATGGAGG - Intronic
1165906203 19:39196361-39196383 CAGAGTGGGGAGGGGGAGGAGGG + Intergenic
1166357693 19:42236745-42236767 CACTGTGAGAAGAGTGAGGAGGG + Intronic
1166813347 19:45527114-45527136 CAGGGTGGGAAGGAAGATGAAGG - Intergenic
1166976902 19:46610108-46610130 AAGGGTGGGGAGAGGGAAGATGG + Exonic
1167272242 19:48511926-48511948 AAGGGTGGGAGGAGGGAGGATGG + Intronic
1167429674 19:49447262-49447284 CAGTGTGGGAGGATGGAGGGAGG + Intronic
1167481648 19:49735749-49735771 CAGTGTTGGACCAGGGAGGATGG + Intergenic
1167489698 19:49785126-49785148 CAGTGTTCGAAGAGAGATAATGG + Intronic
1167780601 19:51596365-51596387 CAGAATGAGAAGAGGGGTGATGG + Intergenic
1168002393 19:53459521-53459543 AAGTTTGGGAAGAGGAATAATGG + Intergenic
1168020709 19:53606832-53606854 CAGATGGGGAAGAGGGAAGAGGG - Intergenic
1168153607 19:54461589-54461611 CACTGGGGGCAGAGGGAGGAGGG - Exonic
1168184755 19:54692577-54692599 AAGGGTGGGAAGAGGGGAGAGGG + Intronic
1168517069 19:57017533-57017555 CAGAGGGAGAAGGGGGATGAGGG - Intergenic
1168557223 19:57353222-57353244 CAGAGTGGCATGGGGGATGAGGG + Intronic
925516987 2:4693501-4693523 CTGCGTGGGGAGAGGGAAGACGG + Intergenic
925907271 2:8547001-8547023 CTGTGAGGGAAGAGAGGTGAAGG - Intergenic
926197600 2:10773139-10773161 CTGTGTGTCAGGAGGGATGAAGG + Intronic
926308812 2:11659755-11659777 CAGCCTGGGAAGAGGGAGCACGG - Intronic
926488643 2:13495864-13495886 GAGGGTGGGGAGTGGGATGAGGG + Intergenic
926630448 2:15130794-15130816 CAGTGTGGGAAGAGAGAGGGTGG - Intergenic
926706280 2:15840063-15840085 TAGTGTGTGAGGAGGGGTGAAGG - Intergenic
926846965 2:17152044-17152066 CAGTGATGGAGGAGGGATGGTGG + Intergenic
926955894 2:18299472-18299494 CAATGTGGGAAGACGGCTTAAGG - Intronic
927151355 2:20198302-20198324 CGGTGTTGGGAGAGGGAGGAAGG + Intergenic
927190869 2:20516073-20516095 CAGTGTGGGAGCAGGGCAGAGGG + Intergenic
928910629 2:36417227-36417249 CAGTAGGGGAAGAGAGAAGAGGG - Intronic
928931741 2:36632019-36632041 GAGTGTGGCAAGAGGAAGGAGGG + Intronic
929021599 2:37558829-37558851 GAGAGTGGTATGAGGGATGAAGG - Intergenic
929277364 2:40040968-40040990 AAGTGTTGGGAGGGGGATGAGGG - Intergenic
929557120 2:42932384-42932406 CAGTGGGGACAGAGGGACGATGG - Intergenic
929562210 2:42963014-42963036 CAGGGAGGGAGGAGGGAAGAGGG - Intergenic
929564887 2:42978137-42978159 GAGAGTGGGAAGAAGGAAGAGGG + Intergenic
930188211 2:48431093-48431115 CACTGTGGGAAATGGCATGATGG + Intergenic
930435123 2:51331058-51331080 CATTCTGGGAAGAGGGTTGCAGG + Intergenic
931296130 2:60927851-60927873 CAGACTGGGAAGGGGCATGAAGG - Exonic
932029457 2:68168457-68168479 GAGTGTGGGAAGAGGGAAGCTGG + Intronic
932111259 2:69003197-69003219 CAGTGAGGGAATAGAGCTGAAGG + Intergenic
932216608 2:69970187-69970209 CAGGGTGTGAAGAGGCATGGAGG - Intergenic
932258073 2:70303812-70303834 CAGTGTTGGAAGAGGTGTGCTGG + Intergenic
932422691 2:71610971-71610993 CATTATGGGAGGAGGGGTGACGG + Intronic
932468116 2:71936486-71936508 CACTCTGGGAAGAGGGTGGATGG - Intergenic
932481558 2:72042426-72042448 TGGTGTGGTAAGAGGGATAAAGG + Intergenic
932609445 2:73187917-73187939 TAGTGTGGGAAGGGGGATTATGG - Intergenic
933689437 2:85168398-85168420 AAGTGTGGGAACAGTGAAGATGG + Intronic
934084581 2:88499365-88499387 CATTGGGGGAAGCTGGATGAAGG - Intergenic
934578988 2:95423228-95423250 AAGGGTGGGAGGAGGGGTGAGGG + Intergenic
934600459 2:95653475-95653497 AAGGGTGGGAGGAGGGGTGAGGG - Intergenic
934736051 2:96690410-96690432 AGGTGTGGGAAGAGGGAGGGAGG + Intergenic
934970779 2:98762426-98762448 TACTGTGGAAGGAGGGATGAAGG - Intergenic
935227354 2:101064412-101064434 CAGTGTGTGGAGGGGGATGGAGG + Intronic
935290315 2:101604655-101604677 CCCTGAGGGATGAGGGATGAGGG - Intergenic
935494667 2:103765419-103765441 GTGTGTGGGCAGAAGGATGAGGG - Intergenic
935671361 2:105559754-105559776 CAGTGAGGGAAGAGAGGGGAGGG - Intergenic
936488323 2:112946579-112946601 CAGTGTAGCAAGAGGGAGGGAGG - Intergenic
936504502 2:113094701-113094723 AAGGGTGGGAGGAGGAATGAGGG - Intergenic
936533817 2:113295536-113295558 AAGGGTGGGAGGAGGGGTGAGGG - Intergenic
937005046 2:118503785-118503807 TAGAGTGGGAAGAGGGAGGAAGG + Intergenic
938299308 2:130198853-130198875 CTGGGTGGGAACAGGGAAGAGGG - Intergenic
938317259 2:130338775-130338797 CACTGTGCGAAGAGAGATGGGGG - Exonic
938320589 2:130359677-130359699 CCTTGTGGGAGGAGGGAGGAGGG + Intronic
938457407 2:131475684-131475706 CTGGGTGGGAACAGGGAAGAGGG + Intronic
938521904 2:132078942-132078964 CAGTGTGGGGGGATGGGTGAGGG + Intergenic
938558325 2:132446820-132446842 GATTGTGGGGACAGGGATGAAGG + Intronic
938922557 2:136008491-136008513 CACTGTGGAAGGCGGGATGAGGG + Intergenic
938934394 2:136116362-136116384 CAGGGAGGGAAGAGGGGAGAAGG + Intronic
939230159 2:139414038-139414060 AAGTGTGGGAAGGGGGGTGAGGG - Intergenic
939501840 2:142996537-142996559 CAGTGAAAGAAGAGGGATGTTGG + Intronic
939535379 2:143421414-143421436 CAGGGTGGGAAGAGAAAAGAAGG + Intronic
940003381 2:148989104-148989126 AAGGGTGGGAAGTGGGGTGAGGG - Intronic
941689577 2:168485498-168485520 CAGTGTGGGGGGAGGCATAAAGG - Intronic
942371159 2:175286804-175286826 CAGTCTGGGACAAGGGCTGAGGG - Intergenic
942399139 2:175582730-175582752 AAGCGTGGGAAGAAAGATGAAGG + Intergenic
942483910 2:176419397-176419419 CAGTGTGGGAAGAGAGAAGGGGG - Intergenic
942919661 2:181356380-181356402 CAGTGTGGGTTCAGGGATGGGGG - Intergenic
943430589 2:187796200-187796222 AAGTGTACCAAGAGGGATGATGG + Intergenic
944148983 2:196537305-196537327 CAGGGTGGGAGGTGGGAAGATGG + Intronic
944405329 2:199377586-199377608 GAGTGCAGGAAGAGGGAAGAAGG + Intronic
945523442 2:210858709-210858731 CTATGTGTGAAGAAGGATGACGG - Intergenic
945586637 2:211673186-211673208 CAGTGTGAGAAGATGGAAGATGG - Exonic
946906433 2:224421229-224421251 CACTGGGGGAAGCTGGATGAAGG - Intergenic
947117762 2:226790667-226790689 CAGTGATGCAAGAGGGATGTTGG + Intronic
947521191 2:230847334-230847356 CAGTGACGTAAGAGGAATGAAGG - Intergenic
948176653 2:235948790-235948812 CTGTGTGGCAAGTGGGAGGATGG - Intronic
948453457 2:238093013-238093035 CAGGGTGGGAAGAGGGTTGGAGG - Intronic
948577699 2:238965145-238965167 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948577742 2:238965295-238965317 AAGTGAGGCAAGAGGGAAGAGGG - Intergenic
948676571 2:239600511-239600533 CAGAGTGGGAAGGGGGCTGAGGG + Intergenic
948795249 2:240399238-240399260 CAGTGTGGGCAGAGAGAGGTGGG - Intergenic
1169888257 20:10426308-10426330 CAGTGTGTGATCACGGATGAGGG + Intronic
1170030065 20:11935456-11935478 AGCTGTTGGAAGAGGGATGAAGG + Intergenic
1170195589 20:13686094-13686116 CAGTTGGGGAATATGGATGAAGG + Intergenic
1170458621 20:16556045-16556067 CAGTGTTGGAAGGGGGAGGATGG - Intronic
1171089614 20:22271568-22271590 CAGAGTGGGAAGAGGGCTCATGG + Intergenic
1171305216 20:24099489-24099511 CAGTGAGGGAAGAGTAAGGAGGG - Intergenic
1171370924 20:24661493-24661515 GAGGGAGGGAAGAGGGAGGAAGG + Intronic
1172230802 20:33334295-33334317 GAATGTAGGAAGATGGATGACGG + Intergenic
1172600921 20:36182382-36182404 CTGTGTGGGACTATGGATGAGGG + Intronic
1172744225 20:37194203-37194225 CTGTGTGGGAAGAGAGAAGGTGG + Intronic
1172747351 20:37222238-37222260 CAGTGGAGGAGGAGGGACGATGG - Intronic
1172763692 20:37339510-37339532 CAGGGTGGAAAGAGGGGTGGGGG - Intergenic
1173188067 20:40856555-40856577 CAGTGTGGGGAGAGGGTGGTTGG - Intergenic
1173259723 20:41422878-41422900 CAGTGTGGGTTCAGGGCTGATGG - Intronic
1173575872 20:44112768-44112790 CAGGGTGGGAAGAGGGGTTAAGG - Exonic
1173583662 20:44165665-44165687 CAGTGAGGGAAAGGGGAGGATGG - Intronic
1174299180 20:49569127-49569149 CAGGGTGGGAATGGGGATGGTGG - Intergenic
1175648769 20:60698444-60698466 TAGTGAGGGAACAGGGATCAGGG - Intergenic
1176033099 20:63023319-63023341 AAGGGTGTGAAGAGGGAAGAGGG - Intergenic
1176250050 20:64116336-64116358 CAGTCTTGGAAGAGTGGTGATGG + Intergenic
1176729584 21:10480001-10480023 TGGTGTGGTAAGAGAGATGATGG + Intergenic
1176774775 21:13122121-13122143 CAGTGTGGGGGGATGGGTGAGGG - Intergenic
1177817061 21:25988778-25988800 TCGTGTGGGAAGGGGGCTGAGGG - Intronic
1177837547 21:26201332-26201354 CAATGTGGTAAGATGGATGGAGG - Intergenic
1178730816 21:35101037-35101059 CAGAGAGGGAAGAGGGTTGAGGG - Intronic
1178832842 21:36070729-36070751 CATTGGGGGAAGGAGGATGAAGG - Intronic
1179015953 21:37594665-37594687 CAGTGTGGAAACTGGGCTGAGGG + Intergenic
1179122658 21:38562802-38562824 GAGTGTGGGAGGTGGGTTGAGGG + Intronic
1180124041 21:45775649-45775671 CAGTGTGGGAAGACTGCTTAAGG - Intronic
1182308855 22:29390466-29390488 CATTGTGGGAAGCTGGGTGAAGG - Intronic
1182476967 22:30581670-30581692 CAGTGTGGGTGCAGGGATGGGGG + Intronic
1182497344 22:30718820-30718842 CAGCATGGGAACAGGGCTGATGG + Intronic
1182536742 22:31009368-31009390 CAGTATGGAAATAGGGAAGAAGG + Intergenic
1183385440 22:37511487-37511509 CAGAGTGGGAGGAGGAAAGAAGG + Intronic
1183487391 22:38096928-38096950 CAGGGAGGGAAGAGGGAAGAAGG + Intronic
1183600999 22:38840616-38840638 CAGTGTGGTTAGGGGGCTGATGG + Intronic
1184094590 22:42309610-42309632 CAGTGTGGGCAGAGGTGTGGAGG - Intronic
1184279393 22:43428394-43428416 CAGGGTGGGCACAGGGATGAGGG + Intronic
1184689425 22:46110706-46110728 CAGGGTGGGGTGAGGGCTGAAGG - Intronic
1185001160 22:48246850-48246872 GAGGGAGGGATGAGGGATGATGG + Intergenic
1185104028 22:48857346-48857368 CACTGTAGGAAGAGGCAGGAAGG - Intergenic
949515505 3:4803571-4803593 CAGTGTGGGGAGGGGAATGTAGG + Intronic
949748359 3:7322550-7322572 GGGTGGGGGAAGAGGGGTGAGGG - Intronic
949946402 3:9193323-9193345 CACTGTGGGCAGAGGGCTAAGGG - Intronic
950230379 3:11271015-11271037 GAATATGGGAAGTGGGATGAAGG - Intergenic
950335570 3:12190250-12190272 CAGTGTGGGAACAAGGGAGAAGG - Intronic
950418003 3:12879611-12879633 CAGTGTGGAAACTGGGATGCTGG - Intergenic
950881544 3:16326560-16326582 CCATGTGGGAAGAGGGGTGCAGG + Intronic
953391350 3:42535699-42535721 CAGTGAGTGGGGAGGGATGAGGG + Intronic
954132075 3:48566018-48566040 CTGTGTGGGGAGTGGGATGATGG - Intronic
954425441 3:50440633-50440655 CAGTGTGGGAGCAGAGAGGAGGG + Intronic
954516723 3:51184778-51184800 CAATGTGGAAAGGGGGCTGAGGG + Intronic
954683927 3:52360435-52360457 CAGTGTGGGAAGGAGCAAGAGGG - Intronic
954689839 3:52389787-52389809 AAATGTGGGGAGAGGGATTAGGG + Intronic
954713132 3:52514682-52514704 CAGGCTGGGGAGAGGGATGGAGG - Exonic
954793117 3:53147450-53147472 CAGCGTGGGAAGTGGTGTGAGGG - Intergenic
955109714 3:55936373-55936395 CATTCTAGGAGGAGGGATGATGG + Intronic
955695583 3:61632798-61632820 CAGGGAGGGGAGGGGGATGAAGG - Intronic
955803965 3:62714523-62714545 CAGTGTGGGTGAAGGGAGGAAGG + Intronic
956122059 3:65976381-65976403 CACTGTGGGGAGACGGAGGAGGG + Intronic
956187475 3:66576372-66576394 CACTGTGGGAGGTAGGATGATGG + Intergenic
956214253 3:66832113-66832135 CACTGGGGGAAGCTGGATGAAGG - Intergenic
956530487 3:70212345-70212367 CAGTTTGGGGAGAAGAATGAGGG - Intergenic
956700233 3:71952332-71952354 CAGTGATGGCAGAGGGAGGAAGG - Intergenic
956847338 3:73195671-73195693 CAGGGTGGGGAGTGGGAGGAAGG - Intergenic
956912188 3:73829494-73829516 TAGTTTGGGTAGAGAGATGATGG - Intergenic
957144045 3:76398576-76398598 CAGTGTGTGAAAATGGAAGAGGG - Intronic
957569164 3:81924266-81924288 CAGTGAGGGATGAGGGAAGAGGG + Intergenic
958053331 3:88377245-88377267 AAGTTTGGGAAGAATGATGATGG - Intergenic
958085363 3:88798739-88798761 CATGGTGGGTAGAGGGATGCTGG - Intergenic
959779219 3:110207988-110208010 GAGTGTGGGGGGTGGGATGAAGG + Intergenic
959922801 3:111887405-111887427 CATTGTGGTAAAAGGGATGACGG + Intronic
960242730 3:115364729-115364751 CAGAGTCGGAATAGGGATAAAGG + Intergenic
960421969 3:117457627-117457649 CAGTGTGTAAGGAGGAATGAAGG + Intergenic
960564206 3:119116979-119117001 CAGTTTGGGAAAAGGGGTGGGGG - Intronic
960591409 3:119369271-119369293 CAGTTGGCAAAGAGGGATGAGGG + Intronic
961095087 3:124147599-124147621 CAGTGGGGGATGCTGGATGAAGG - Intronic
961204299 3:125068618-125068640 CAGTGGGGCAAGAGGGGTGAAGG + Intergenic
961430083 3:126875212-126875234 CAGAGCAGGAAGAGGGAAGAAGG + Intronic
961587992 3:127950272-127950294 CAGGGAGGGAAGTGGGAAGAAGG + Intronic
962415795 3:135180581-135180603 CAGTGCAGGAAGATGGATGAGGG - Intronic
962418718 3:135208118-135208140 CCCTGTGGCAAGAGGGAAGATGG + Intronic
962426632 3:135274504-135274526 CAGTGTGTGAAGATGGGTGTGGG + Intergenic
963020103 3:140864531-140864553 AGGTTTGGGAAGAGGCATGATGG - Intergenic
963127186 3:141827151-141827173 CAGGGTGGGAAGAGAGCTGGTGG + Intergenic
963623333 3:147639723-147639745 AAGTGTGGGAGGTGGGGTGAGGG + Intergenic
963634858 3:147781743-147781765 GAATGTTGGAAGAGGAATGAGGG - Intergenic
964162354 3:153660513-153660535 CAGGGAGGGAAGGGGGAGGATGG - Intergenic
965017582 3:163177705-163177727 CAGGGTGGAGAGTGGGATGAGGG + Intergenic
966402543 3:179562687-179562709 CAGTGGGAGAAGAAGGAGGAAGG - Intergenic
966420836 3:179732814-179732836 CAGTGGGGGAAGAGAGACAAGGG - Intronic
966692375 3:182755002-182755024 TAGTGAGAGAAGAGGGTTGAGGG + Intergenic
966716579 3:183018734-183018756 CAGAGAGGGAAGAGGGATGAGGG + Intronic
967292607 3:187935946-187935968 AATAGTGAGAAGAGGGATGAGGG + Intergenic
967653140 3:192011336-192011358 CAGTGTGGTACAAGGGATGAAGG - Intergenic
967807416 3:193728145-193728167 CAGTGTGGGCAAAGGTATGCGGG + Intergenic
967856009 3:194118080-194118102 CAGTCTGAGAAGGGAGATGAGGG - Intergenic
968346882 3:198015957-198015979 CAGTTTGGGAAGAGGGAAGATGG + Intronic
968530704 4:1090006-1090028 CAGGATGGGATGAGGGGTGACGG + Intronic
968659613 4:1793640-1793662 CAGGGAGGGAAGGGGGAGGAGGG + Intronic
969212603 4:5699195-5699217 AGGTGTGGGAAGAGGGAAAATGG + Intronic
969519289 4:7666450-7666472 CAGGGTGGGAGGAGGGAGGAAGG - Intronic
969884907 4:10206697-10206719 CAGTGTGAGGTGGGGGATGACGG + Intergenic
970904245 4:21196930-21196952 TTGAGTGGGAAGAAGGATGAGGG - Intronic
971163911 4:24162428-24162450 CACTGTGGGAATATGGCTGAGGG - Intergenic
971511712 4:27434491-27434513 AAGTGTGGGAATTCGGATGAGGG + Intergenic
971528443 4:27653027-27653049 CACTGTTGGAAGGGGCATGAGGG + Intergenic
972165884 4:36283225-36283247 GAGAGTGGGAAGAATGATGACGG + Intronic
972646228 4:40970126-40970148 GAGATGGGGAAGAGGGATGAGGG + Intronic
973153763 4:46922374-46922396 CAGTGTGGGAAGTGGTGGGAGGG - Exonic
973298345 4:48552160-48552182 CAGTGGGGTAAGAAGGATGTTGG - Intronic
973711433 4:53633721-53633743 CAGAGGAGGAAGATGGATGAGGG - Intronic
973808064 4:54544640-54544662 CAGTGTGGGAAGAGAAAGAAGGG - Intergenic
974133295 4:57783471-57783493 AAGGGTGGGAGGAGGGATGAGGG - Intergenic
974188683 4:58474803-58474825 AAGTGGGGGCTGAGGGATGAGGG + Intergenic
974752651 4:66160767-66160789 CAGGATGGCAACAGGGATGATGG + Intergenic
975496372 4:75039938-75039960 CAGTATGGAAAGGTGGATGAAGG - Intronic
976702243 4:87983711-87983733 GAGAGTGGGAAGGTGGATGAGGG - Intergenic
977510299 4:97953604-97953626 CAGTGTGGGAAGAGCCTTGCAGG - Intronic
977588500 4:98801487-98801509 AAGGGTGGGAAGAGAGCTGAGGG - Intergenic
978103750 4:104876014-104876036 GAGTGTGGGAAGAAGAATTATGG + Intergenic
978437227 4:108698655-108698677 GAGGGTGGAAAGAGGGCTGAGGG - Intergenic
978822977 4:112987262-112987284 CAGTGGGGACAGAGGGATGGTGG + Intronic
978839169 4:113189294-113189316 CTCTGTGGGAAGAGAGAGGAGGG - Intronic
979084201 4:116385714-116385736 CAATGTGGGAAGTGGCATGCAGG + Intergenic
979745620 4:124209326-124209348 CACTTTGGGAAGAGAAATGAGGG + Intergenic
980887217 4:138776169-138776191 GAGTAAGGCAAGAGGGATGAGGG - Intergenic
981436044 4:144723330-144723352 CATGGGGGGAAGAGGAATGAGGG - Intronic
981657126 4:147124576-147124598 CAGAGAGGTAGGAGGGATGAGGG - Intergenic
981981614 4:150799703-150799725 AAGTGTGGTAAGAGGGACAAAGG - Intronic
983994062 4:174159646-174159668 CACTGTGGGAAGAGGTGTGAGGG + Intergenic
985487283 5:158637-158659 CAGGATGGGCAGAGGGAGGAGGG - Intronic
985620672 5:953165-953187 CGGGGTGGGAAGAGGCAGGAGGG + Intergenic
985883120 5:2655899-2655921 CAGTTTGGAAGGAGAGATGATGG + Intergenic
985930741 5:3055737-3055759 CTGGGTGGGAAAAGGGATGTTGG - Intergenic
986708327 5:10469557-10469579 CAGTGTGGGGAGGGGGGTGGTGG + Intronic
987116901 5:14732887-14732909 TAATGAGGGAAGAGGGATGGAGG - Intronic
987615426 5:20267942-20267964 GAGAGTGGGAAGAGGGAAGGAGG - Intronic
988137170 5:27188827-27188849 CAGTGGGGCAAGAGAGATGTGGG + Intergenic
989209968 5:38848551-38848573 CTGAGTGGGAGGAGGGAGGATGG - Intronic
989465292 5:41747842-41747864 CAGTGTGGGCAGAGGTGTCAGGG - Intronic
989638160 5:43557300-43557322 CTGGGGGGGATGAGGGATGAGGG + Intronic
990550469 5:56871978-56872000 CAGTGTGTGAAGACGGCTGCAGG + Exonic
991306137 5:65177979-65178001 TAGTGTTGGAAGAGGGAGGCTGG - Intronic
992093327 5:73338844-73338866 CAGAGCGGGGAGAGGGAGGAGGG + Intergenic
992447952 5:76850733-76850755 AAGAGAGGGAAGAGGGATGGAGG + Intronic
993074128 5:83205806-83205828 CAGGGTGAGAATAAGGATGAGGG + Intronic
993164967 5:84341032-84341054 CTATGTTGGAGGAGGGATGAGGG - Intronic
993711294 5:91228268-91228290 CAGTATGGGAAGAATGATCAAGG - Intergenic
994022129 5:95039447-95039469 CAGTGGGGGAAGGGGGTTGTGGG + Intronic
995039417 5:107571137-107571159 GAGTGGGGGAAGAGGGCTTAGGG + Intronic
995600261 5:113788464-113788486 AAGTGTGGTAAGAGGAAGGAGGG + Intergenic
996879597 5:128280676-128280698 AGGTGTGGGGAGAGGGATGGTGG + Intronic
997197429 5:131989258-131989280 CAGGGTGGGAAGAGGAGTGGTGG + Intronic
997368033 5:133338356-133338378 CAGGGTGGGAAGATGGAGCATGG - Intronic
997582948 5:135028625-135028647 CGGAGTGGGAAGTGGGAGGAGGG + Exonic
998050473 5:139028614-139028636 CATTGAGGGAAGCTGGATGAAGG - Intronic
998116301 5:139540244-139540266 CATTGGGGGAAAATGGATGAAGG + Intronic
998205062 5:140152174-140152196 AAGTGAGGCAAGAGGGATGACGG + Intergenic
998516306 5:142757677-142757699 CAGAGTGGGCAGAGGGAGAAGGG + Intergenic
999258223 5:150221787-150221809 GGGTGTAGGAAGAGGGGTGAGGG - Intronic
1000494764 5:161967975-161967997 CAGTGTGGCAAGAACGAGGATGG - Intergenic
1001536708 5:172503177-172503199 CAGTGTGAGCAGAGGGATCCAGG + Intergenic
1002338325 5:178495659-178495681 GAGAGTGGGAAGGGGGAGGAAGG + Intronic
1002361631 5:178676357-178676379 CATTGAGGGAAGCCGGATGAAGG - Intergenic
1002517120 5:179766830-179766852 AGTTGTGGGAAGAGGGAGGAGGG + Intronic
1002780180 6:359340-359362 GGGTCTGGGAAGAGGGGTGAGGG + Intergenic
1003335499 6:5168129-5168151 CAGTGGGAGAAGAGAGAGGAAGG + Intronic
1003499927 6:6695559-6695581 GAGTGTGGGCTGAGGGATGGTGG + Intergenic
1003661556 6:8067024-8067046 CAGGGTGGGGACAGGGAGGAAGG - Intronic
1004278089 6:14255691-14255713 CAGTGGGGAAAGAGGCGTGATGG - Intergenic
1004466051 6:15886034-15886056 CAGTGTGGTAAGAGTAATGATGG - Intergenic
1004943285 6:20584497-20584519 CAGTGTGGGGAGAGGAAGGAAGG + Intronic
1005088094 6:22027514-22027536 CAGTGTGGGGAGAGAGAATAGGG + Intergenic
1005245954 6:23885441-23885463 CACTGTGGAAGGAGGGGTGAAGG - Intergenic
1006042649 6:31268986-31269008 CAGTGTGGGGACAGGGGTCACGG + Exonic
1006163620 6:32051965-32051987 CAGTGTGGGAAGAGGAGTTCTGG + Intronic
1006351444 6:33524196-33524218 CAGGGAGGGGAGAGGGCTGAAGG + Intergenic
1007067079 6:39001621-39001643 GAGTGTGGGAAGAAGAAAGAAGG + Intronic
1007766670 6:44164715-44164737 AAGGATGGGAAGAGGAATGAGGG + Intronic
1009328183 6:62380362-62380384 CAAAGGGGAAAGAGGGATGATGG + Intergenic
1009837280 6:69018441-69018463 CATTGTTGGAATGGGGATGATGG + Exonic
1011717041 6:90117343-90117365 GAGAGAGGGAAGAGGGAAGAAGG - Intronic
1012036907 6:94154077-94154099 CTTTGTGGGAACACGGATGAAGG + Intergenic
1012156509 6:95825762-95825784 GAGTGTGGGAGGTGGGAGGAGGG + Intergenic
1012359678 6:98361724-98361746 CAGTGAGGTCAGAGGGAAGAAGG + Intergenic
1014848727 6:126313507-126313529 CAGTGTCAGAGGAGGGAAGAGGG - Intergenic
1015325502 6:131918937-131918959 CAGTGTGGGGAGGGGGTGGATGG - Intergenic
1016308515 6:142709203-142709225 GAGGGTGGAAAGTGGGATGAGGG - Intergenic
1016361307 6:143270208-143270230 AAGTGTGGGAAGAGGGGGAAAGG - Intronic
1016751420 6:147634447-147634469 CAGTGTTGGAGGAGGGAGGAGGG - Intronic
1017136815 6:151154329-151154351 AAATGGGGCAAGAGGGATGAGGG + Intergenic
1017492758 6:154958781-154958803 CAGGGTGGGCAGCAGGATGAAGG - Intronic
1017503526 6:155046892-155046914 CAGTGTGAGATGAGAGATGCAGG + Intronic
1017869846 6:158478098-158478120 GAGAGTGGGAGGAGGGAGGAGGG + Intronic
1018051927 6:160016650-160016672 CAGGGTGTGGTGAGGGATGATGG - Intronic
1018378182 6:163232908-163232930 CAGAGTTGGGAGAGGGCTGAGGG - Intronic
1018671263 6:166179437-166179459 CAGTGTGGGAAGAGGTGCCATGG - Intergenic
1018950242 6:168374297-168374319 CAGTGGCAGAAGAGGGATGGCGG - Intergenic
1019215888 6:170443563-170443585 CACTGTGGGAAGAGGGCTCTTGG + Intergenic
1019664788 7:2246403-2246425 GAGTGTGGAAGGAGGGAGGAAGG + Intronic
1020334371 7:7051342-7051364 AAGTGTGGCAAGAGGGAGGAGGG + Intergenic
1020427827 7:8090068-8090090 CACTGTGGGATGGAGGATGAGGG - Intronic
1022379408 7:29845705-29845727 CAGAGTCGGATGAGGGATGAGGG + Intronic
1022567265 7:31415898-31415920 CAGCATGGGAAAAGGGTTGATGG - Intergenic
1023659903 7:42460685-42460707 CATTGTCAGAAGAGGAATGATGG - Intergenic
1023817219 7:43960303-43960325 GACTGGGGGCAGAGGGATGAGGG + Intergenic
1024391413 7:48816947-48816969 GAGTGGGGACAGAGGGATGAAGG + Intergenic
1026364352 7:69632601-69632623 CAGAGAGGGAAGAGGGGAGAGGG - Intronic
1026602468 7:71787920-71787942 AGGTGTGGGAAGAAGGAAGAGGG + Intronic
1026809568 7:73451529-73451551 CAGACTGGGGAGAGGGATGAGGG + Intronic
1026988505 7:74569769-74569791 CAGGGTGTGAAGAGGGCGGAAGG + Intronic
1027569554 7:79847234-79847256 CAGAGCTGGAAGAGGGATGGAGG - Intergenic
1028175854 7:87657580-87657602 CATTGTGGGAAGGGGGGTGTTGG - Intronic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1028751861 7:94391863-94391885 TAGTGTGGGGAGAGGGGAGAGGG - Intergenic
1028968333 7:96827788-96827810 AAGTGTGGGAAGTGTGAAGAGGG - Intergenic
1029270183 7:99372943-99372965 CCCTGTGGGAAGAGGGCTGCCGG + Intronic
1029412782 7:100426667-100426689 GAGGGAGGGAAGAGGGAGGAAGG - Intronic
1031643246 7:124191018-124191040 CAGAGGGGGCAGGGGGATGATGG - Intergenic
1032072383 7:128816247-128816269 CAGTGCCAAAAGAGGGATGAGGG - Intronic
1032254192 7:130284123-130284145 CAGTGTGGATGGAGTGATGAGGG + Intronic
1032587535 7:133161272-133161294 CAATTTGGGAAGAGTGATGAGGG + Intergenic
1033318609 7:140319051-140319073 TAGTGTGGTAAGAGCTATGATGG - Intronic
1033522557 7:142175844-142175866 CATTGTGGGAAACTGGATGAAGG + Intronic
1033616041 7:143015089-143015111 CTGTCTGGGAAAAGGGAGGAAGG + Intergenic
1033630910 7:143156722-143156744 AAGTGTGGGAAATGGGGTGAGGG + Intergenic
1033671089 7:143493926-143493948 GTGTGTGGGAGGAGGGGTGAAGG - Intergenic
1034347917 7:150398278-150398300 CAGCGTGGGTTGAGGGAGGAGGG + Exonic
1034600000 7:152241571-152241593 TGGTGTGGTAAGAGAGATGATGG - Intronic
1035335447 7:158124988-158125010 CAGGGTGGGAGAAGGGAAGAGGG + Intronic
1036190038 8:6661852-6661874 CTGTGTGGGGAAAGGGCTGATGG + Intergenic
1036617051 8:10396318-10396340 CTGAGTGGGAAGAGCTATGAAGG + Intronic
1036660093 8:10702297-10702319 CAGTGGGGGCTGAGGGAGGAGGG - Intronic
1036918410 8:12828056-12828078 CAGTGTGGGATGATGGGAGAGGG + Intergenic
1038328702 8:26591113-26591135 CAGAGTAGGAACTGGGATGAGGG - Intronic
1039474000 8:37829825-37829847 CAGGGTGGGCAGAGGGGTCACGG - Intronic
1039598092 8:38809068-38809090 CAGGCTGGGCAGAGGGCTGAAGG - Intronic
1039772678 8:40703577-40703599 CAGTGGGGGAGCAGGGAGGAGGG + Intronic
1040042616 8:42931739-42931761 CGGGATGGGAAGAGGGAAGAGGG - Intronic
1041261909 8:56028246-56028268 CAGTGTGGAGGGAGGGAGGACGG + Intergenic
1041322124 8:56624162-56624184 CAGTGTCTGAAGAGGTAGGAGGG - Intergenic
1041796893 8:61754345-61754367 CAGAGAGGAAAGAGGGAGGAGGG - Intergenic
1042014903 8:64298159-64298181 GAGTGTGCGAATATGGATGAAGG + Intergenic
1042015032 8:64299431-64299453 CACTGTGGTAAGAGCTATGAAGG - Intergenic
1042579643 8:70262689-70262711 CAATGTGGGAGGAGGCAAGAAGG + Intronic
1043363997 8:79510363-79510385 CAATGTCGGGAGAGGGATGGGGG + Intergenic
1043733648 8:83717510-83717532 CAGTGTGGGAAAATGGGGGAAGG + Intergenic
1043911382 8:85868425-85868447 GGGGGTGGGAGGAGGGATGAGGG - Intergenic
1043979471 8:86621625-86621647 AAGGGTGGGAAGGGGGGTGAAGG - Intronic
1044257182 8:90078392-90078414 CAGTATGGGCAAAGAGATGATGG - Exonic
1044915744 8:97111196-97111218 CATTGTGGGAAAAGGTATGGAGG - Intronic
1044931262 8:97253944-97253966 AAGTGTGGTAAGAGAGATGTGGG - Intergenic
1045915453 8:107464837-107464859 CAGTGTGGTAAGTGTGTTGATGG + Intronic
1046002426 8:108437131-108437153 CAGTGGGGATAGAGGTATGATGG - Intergenic
1047358420 8:124144940-124144962 AAGTGTGGGAAAAGGGAGGATGG + Intergenic
1047670018 8:127135953-127135975 CAGAGTGAGAAGAGGGCTGGAGG - Intergenic
1048101812 8:131360246-131360268 CAGAGTGGCAAGTTGGATGAAGG - Intergenic
1048492388 8:134906199-134906221 CAGTGGGGAAAGAGGGATGCTGG - Intergenic
1049236748 8:141515933-141515955 CAGTGTGAGGAGAGAGACGATGG - Intronic
1049359294 8:142204348-142204370 CAGGGTGCGAGGCGGGATGAGGG - Intergenic
1049377860 8:142297538-142297560 GAATGTGGGAGGAGAGATGAGGG + Intronic
1049610230 8:143551743-143551765 CAGTGGGGAGAGTGGGATGAGGG - Intergenic
1049812622 8:144582278-144582300 AAGGGTGGGACGTGGGATGAAGG - Intronic
1050450431 9:5774879-5774901 CAATGTGGGCAGAGGTCTGAGGG + Exonic
1050457721 9:5849506-5849528 TGGTGTGGGAAGAGAGATGAAGG - Intergenic
1050714277 9:8504044-8504066 CAGTGTAGGAAGTGGGAAGGTGG + Intronic
1050827167 9:9961649-9961671 GAGTGTGGGAAGCAGGATGCTGG + Intronic
1051584208 9:18710118-18710140 GAGTGTGGGAAGCTGGAGGAGGG - Intronic
1054714770 9:68546482-68546504 CAGTGTTGAAAGAGTGATTATGG - Intergenic
1054840301 9:69731210-69731232 GAGCATGGGAAGAGGGATGTAGG + Intronic
1055055049 9:72015729-72015751 CAGTGTGGGAAGAAGGGTACGGG + Intergenic
1055231491 9:74072263-74072285 CAGAGTGGCAAGTTGGATGACGG - Intergenic
1056543983 9:87597811-87597833 CAGTGTGAGCAGAGGCAGGAAGG - Intronic
1056779515 9:89538858-89538880 CAGTGTGTGCAGTGGGGTGATGG + Intergenic
1058654782 9:107210249-107210271 AAGGGTGGGATGGGGGATGAAGG + Intergenic
1059433705 9:114264430-114264452 CAGTGTCGGAGGAGTGAGGAAGG - Intronic
1059747502 9:117217349-117217371 CTGAGTGGGATGAGGAATGAAGG - Intronic
1060056029 9:120413800-120413822 CAGTGAGCGAGGAGGGAGGAGGG + Intronic
1060446883 9:123697683-123697705 AAGTGGGGGAAGGGGGAGGAAGG - Intronic
1060549924 9:124480063-124480085 CAGTGTGAGCAGAAGGATGGAGG - Intergenic
1060673672 9:125493057-125493079 CAGTGTGTGAAGCGGAATGGTGG + Intronic
1060809841 9:126605293-126605315 TAGAGTGGGAAGAGGGCTCACGG - Intergenic
1061418168 9:130459287-130459309 CAGCTTGGGAAGATGGAGGACGG - Intronic
1061571745 9:131482048-131482070 CTGGGTGGGAAGAGGGATTCAGG + Intronic
1203584686 Un_KI270746v1:54074-54096 TGGTGTGGTAAGAGAGATGATGG - Intergenic
1186530777 X:10293095-10293117 CAGTGTGGGAAGAGGGTGAGAGG + Intergenic
1187378533 X:18779265-18779287 GTGTATTGGAAGAGGGATGAGGG + Intronic
1188768532 X:34125951-34125973 CGGTGTGGGAGGTGGGAGGAAGG + Intergenic
1189192061 X:39118847-39118869 CAGTGAGGGAGGAGGGAAGCAGG + Intergenic
1189209085 X:39267654-39267676 CAGTTTGGGAGGAAAGATGATGG - Intergenic
1189539761 X:41973556-41973578 CAGGTTGGGAAGAGGGATTTTGG + Intergenic
1190076720 X:47322416-47322438 CAGTGTGGGAGGGAGGAGGAGGG - Intergenic
1194352006 X:92832683-92832705 AGGTGTGGGAAAAGGAATGAAGG - Intergenic
1194968810 X:100320082-100320104 CGTTGTGGCAAGAGGAATGAGGG - Intronic
1194992930 X:100564111-100564133 CAGTGGAGGAAGAGGGAAGAGGG + Intergenic
1195008026 X:100706063-100706085 CAGTTGTGGCAGAGGGATGAAGG - Intronic
1196950069 X:120868232-120868254 CACTGTGAGAAAAGGGAGGAAGG - Intergenic
1197658359 X:129142675-129142697 CAGTAATGGAAGAGGAATGAAGG + Intergenic
1197708395 X:129649876-129649898 CAGTGAGGGAAAAGGCATGCAGG + Intronic
1197841933 X:130757495-130757517 CAGGGAGGAAAGAGGTATGATGG + Intronic
1198166785 X:134065419-134065441 CAGTGTGGGGAGGGGTAGGATGG - Intergenic
1198801440 X:140451911-140451933 CACAGTGGTAAGAGGAATGAGGG + Intergenic
1199438722 X:147843952-147843974 GAATGGGGGATGAGGGATGAGGG + Intergenic
1199532613 X:148867372-148867394 CAGTCTGGTAAAAGAGATGAGGG + Intronic
1199610103 X:149605639-149605661 CAGTGTGGGAAAAAGAATGCAGG - Intronic
1199829225 X:151532337-151532359 CAGTATGCCAAGAGGGCTGAGGG + Intergenic
1200660314 Y:5949369-5949391 AGGTGTGGGAAAAGGAATGAAGG - Intergenic