ID: 1074764559

View in Genome Browser
Species Human (GRCh38)
Location 10:116691198-116691220
Sequence CAGGGGAAGCAGCCTGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074764548_1074764559 11 Left 1074764548 10:116691164-116691186 CCAGATTCTCACACTGCAAGGAG 0: 1
1: 0
2: 1
3: 10
4: 173
Right 1074764559 10:116691198-116691220 CAGGGGAAGCAGCCTGGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074764559 Original CRISPR CAGGGGAAGCAGCCTGGGGA AGG Intronic
No off target data available for this crispr