ID: 1074765869

View in Genome Browser
Species Human (GRCh38)
Location 10:116699597-116699619
Sequence TAGGTCAGGATGCCACAGAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 178}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074765869_1074765876 22 Left 1074765869 10:116699597-116699619 CCCGTCTGTGGCATCCTGACCTA 0: 1
1: 0
2: 1
3: 21
4: 178
Right 1074765876 10:116699642-116699664 AGCCAGCTGCCTTCTGCTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074765869 Original CRISPR TAGGTCAGGATGCCACAGAC GGG (reversed) Intronic
901113070 1:6814946-6814968 TAGATCAGGATGTTACACACAGG - Intronic
901463616 1:9406453-9406475 AAGTTCAGGGTGCAACAGACGGG - Intergenic
903167416 1:21530648-21530670 TAGGTCAGAATTCTTCAGACTGG + Intronic
905939572 1:41852438-41852460 TAGGCCAGAATCCCAGAGACAGG + Intronic
906521506 1:46469580-46469602 CAGGGCAGGCTGCCCCAGACTGG - Intergenic
907899323 1:58723065-58723087 TATGACAAGATACCACAGACTGG + Intergenic
908531031 1:65034253-65034275 GAGATCAGGATGGCACAGATGGG + Intergenic
911247594 1:95535652-95535674 GAGGTCAGGATGCCATTGCCCGG - Intergenic
914981186 1:152415839-152415861 TAGATCAGCATGCAACAGACAGG + Intergenic
917116680 1:171610420-171610442 TAAGGCAGAATACCACAGACTGG + Intergenic
918553578 1:185772718-185772740 TATAACAGAATGCCACAGACTGG + Intronic
920963811 1:210686018-210686040 GAGGTCAGAAAGCCACATACTGG - Intronic
921072986 1:211677410-211677432 TATAATAGGATGCCACAGACTGG - Intergenic
921124857 1:212168299-212168321 TATAACAGGATACCACAGACTGG - Intergenic
921140375 1:212299551-212299573 TAGGTCAGGATAACAGAGACTGG + Intronic
921598256 1:217078655-217078677 TAGGTCAGGACAGCAGAGACAGG - Intronic
921893273 1:220373636-220373658 TATTACAGAATGCCACAGACAGG + Intergenic
1065064524 10:21947092-21947114 TATGACAGAATACCACAGACTGG - Intronic
1066179738 10:32948803-32948825 TATAACAGAATGCCACAGACTGG - Intronic
1069042702 10:63711605-63711627 AAGGGCAGGATGCCACAGTGCGG - Intergenic
1069106037 10:64384556-64384578 AAGGTCAGAATGACACAGTCTGG - Intergenic
1072299148 10:94042104-94042126 TAAATCAGGAAGCCACAGACTGG - Intronic
1072826441 10:98611337-98611359 TAGGCTAGAATGCCACAAACTGG + Intronic
1073001152 10:100286951-100286973 TTGGTCAGCAGGCCACAAACAGG - Intergenic
1074765869 10:116699597-116699619 TAGGTCAGGATGCCACAGACGGG - Intronic
1075062302 10:119265641-119265663 CAGCTCAGGCTGCCATAGACTGG - Intronic
1075676628 10:124300290-124300312 TAGGCCAGGGTGACACAGGCTGG + Intergenic
1076890111 10:133279206-133279228 CAGGGCAGGAGGCCACAGACAGG - Exonic
1081480868 11:43487703-43487725 TAGAACAAAATGCCACAGACAGG + Intronic
1083890809 11:65595022-65595044 TGGATCAGGAGGGCACAGACAGG - Intronic
1084322052 11:68378499-68378521 TGGGTCAGGATGCCGGGGACAGG - Intronic
1085316572 11:75548672-75548694 TAGGTCAGGATGCCCAGGTCAGG - Intergenic
1085925821 11:81019260-81019282 TATATCAGGGTACCACAGACTGG - Intergenic
1089067998 11:115676609-115676631 TGGGTCAGGCTGTCACAGGCAGG + Intergenic
1089917282 11:122170277-122170299 TATGACAGAATACCACAGACTGG - Intergenic
1095294051 12:40508295-40508317 TAGCTCAGTGGGCCACAGACAGG - Intronic
1097349677 12:58535035-58535057 TAGGACTGGATGCTATAGACAGG + Intergenic
1098984514 12:76997243-76997265 TATAACAGAATGCCACAGACTGG - Intergenic
1099599989 12:84722461-84722483 TATATCAGGATACCACAGACTGG - Intergenic
1100164725 12:91903403-91903425 TATGACAGAATACCACAGACTGG + Intergenic
1100676913 12:96878359-96878381 TGGGATAGGATGCCACAGAAGGG - Intergenic
1104097633 12:125572543-125572565 TATAACAGAATGCCACAGACTGG - Intronic
1105670166 13:22604504-22604526 TACAACAGAATGCCACAGACTGG - Intergenic
1106233191 13:27838558-27838580 TATGACAGAATGCTACAGACTGG - Intergenic
1109151719 13:58856690-58856712 CAGGTCAGCAGGCCACTGACTGG - Intergenic
1111385938 13:87527669-87527691 TATAACAGAATGCCACAGACTGG + Intergenic
1113526215 13:110979818-110979840 TATAACAGAATGCCACAGACTGG - Intergenic
1116623288 14:47233962-47233984 TAGTTCAGGAGGCAACAAACAGG - Intronic
1116870436 14:50064512-50064534 TAGGACAGGAATCCACAGACTGG - Intergenic
1117390129 14:55254877-55254899 TGGGTCAGGATCCCAGAGAAAGG + Intergenic
1119167023 14:72503059-72503081 AAGGTCGAGATGCCACAGATTGG + Intronic
1119628944 14:76209211-76209233 TAGGTCAGTCTAGCACAGACTGG + Exonic
1119634267 14:76261365-76261387 TAGATGAGGAAGCCACAGAAAGG + Intergenic
1120295247 14:82632013-82632035 TACATCAGGATGAAACAGACAGG + Intergenic
1121457040 14:94044907-94044929 TAGGTCAGCAAGCTGCAGACAGG + Intronic
1121579801 14:95020959-95020981 TATAACAGAATGCCACAGACTGG + Intergenic
1121613364 14:95296080-95296102 TATAACAGAATGCCACAGACTGG + Intronic
1122670501 14:103368083-103368105 TATAACAGAATGCCACAGACTGG - Intergenic
1122723442 14:103735218-103735240 CAGGACAGGAAGCCACACACAGG + Intronic
1122885881 14:104710068-104710090 TAGCTGGGGATGGCACAGACAGG - Exonic
1127637080 15:60881320-60881342 CAGGCCAGGAGGCCCCAGACAGG + Intronic
1128230996 15:66035073-66035095 TATAACAGAATGCCACAGACCGG - Intronic
1128282702 15:66409554-66409576 TAGGACAGATGGCCACAGACAGG + Intronic
1128672255 15:69582653-69582675 TATGACAGAATACCACAGACTGG + Intergenic
1128749801 15:70140759-70140781 TTTCTCAGGATGCCCCAGACAGG - Intergenic
1129118575 15:73380787-73380809 TATGACAGAATACCACAGACTGG + Intergenic
1130536286 15:84787235-84787257 TAGGGCAGAATGACACAGAGAGG - Intronic
1130881371 15:88058688-88058710 TAGGGGAGGATGCAACAGATGGG - Intronic
1130898886 15:88192335-88192357 TAGGATAGGAGGCCACAGGCTGG - Intronic
1139674144 16:68511364-68511386 GAGGAAAGGATGCCACAGCCTGG - Intergenic
1141316909 16:82971040-82971062 TAGGCCAGTATGCCCCAGAATGG - Intronic
1143719298 17:8798909-8798931 TTGGCCAGGAAGGCACAGACGGG + Exonic
1143976189 17:10831740-10831762 AAGGTCCTGATGCCCCAGACTGG + Intronic
1144148843 17:12423864-12423886 TATGCCATAATGCCACAGACTGG + Intergenic
1145868934 17:28257933-28257955 GAGGTCAGGATGCCCCAGAATGG - Intergenic
1151480763 17:74369001-74369023 GTGGTAAGGCTGCCACAGACAGG - Intronic
1152333524 17:79686755-79686777 GAGGTCAGGAAGCCACAGGGGGG + Intergenic
1155979384 18:32164850-32164872 TGAGTCAGGATGCTGCAGACAGG - Intronic
1156369233 18:36457780-36457802 TAGCTCAGGATGTCACAGCCTGG + Intronic
1159004717 18:63002037-63002059 TAGATCAGGAGGCCTGAGACGGG + Intergenic
1160421457 18:78749801-78749823 TATGACAGAATGCTACAGACTGG - Intergenic
1161245772 19:3250981-3251003 TAGGTGAGGAAGGCACAGCCTGG - Exonic
1164600986 19:29563050-29563072 AACATCAGGATGCCCCAGACAGG + Intronic
925235707 2:2275575-2275597 TAGGGCAGGATGCAGCACACTGG - Intronic
925918599 2:8624397-8624419 TAGGGCAGCTTGCCAAAGACAGG - Intergenic
926587136 2:14699193-14699215 TATGACAGAATACCACAGACTGG - Intergenic
929667845 2:43847382-43847404 TAGGTCAGGATTGCAGGGACAGG - Intronic
932206269 2:69885691-69885713 TATATCAGAATACCACAGACTGG - Intergenic
936276426 2:111101755-111101777 TCAGTCAGGATGACACAGCCAGG - Intronic
937846338 2:126583399-126583421 TAGGTCATGATGCCACTGGTGGG + Intergenic
937932311 2:127216776-127216798 TGGCTCAGCATGACACAGACAGG + Intronic
940659671 2:156531347-156531369 GAGGTCAGGAGAACACAGACAGG + Intronic
941471509 2:165894135-165894157 TGGGTTAGGATACGACAGACTGG + Intronic
943631460 2:190257628-190257650 TATGACAGAATACCACAGACCGG + Intronic
947182878 2:227427642-227427664 TATATCAGAATACCACAGACTGG - Intergenic
948123859 2:235550578-235550600 TCGGTCTGGGAGCCACAGACAGG + Intronic
948845282 2:240680128-240680150 CAGGTAAGGAGGCCACAGGCTGG - Intronic
948848578 2:240694751-240694773 CAGGTAAGGAGGCCACAGGCTGG + Intronic
1171015178 20:21534291-21534313 TAGAACAGAATACCACAGACTGG - Intergenic
1172648115 20:36484094-36484116 TAGCCCAGGATTACACAGACAGG - Intronic
1174117352 20:48235938-48235960 TAGGACAGCATACCACAGACTGG - Intergenic
1174615205 20:51830095-51830117 TAGGTCAGGTTCCCTCACACAGG + Intergenic
1175633392 20:60560609-60560631 TAGGGCAAGATGCCCCAGAAAGG + Intergenic
1175666148 20:60861657-60861679 TATGTCAAAATACCACAGACTGG - Intergenic
1176044846 20:63087219-63087241 GAGCTCTGGATGCCACAGACAGG - Intergenic
1179013043 21:37571183-37571205 TACAACAGAATGCCACAGACAGG - Intergenic
1180091316 21:45535071-45535093 CAGGACTGGATGCCACAGAAGGG + Intronic
1180968117 22:19801022-19801044 TACGACAGGAGGCCACAGAGAGG - Intronic
1180971602 22:19818986-19819008 TAGGCCAGGAAGCAGCAGACAGG - Intronic
1180983665 22:19891570-19891592 TTGCTCAGGATGCCCCAGCCTGG + Intronic
1185418771 22:50723594-50723616 TAGTTCAGGATTCAAAAGACAGG + Intergenic
949494283 3:4617233-4617255 TATAACAGGATACCACAGACTGG + Intronic
949959794 3:9302491-9302513 TAGGTCAGGATGCCGCAGGGAGG + Intronic
951519079 3:23594492-23594514 TAGGTGTGGAAGCCACAGAGAGG - Intergenic
951553980 3:23902440-23902462 TATGACAGGATGACACAGACAGG - Intronic
952498681 3:33938653-33938675 TATAACAGAATGCCACAGACTGG + Intergenic
953026374 3:39147602-39147624 CATGTCACGAAGCCACAGACAGG - Intronic
953448262 3:42985855-42985877 TTGGTCAGGATGCCAGCAACAGG + Intronic
953838115 3:46365626-46365648 TTGGTCAAGATGCCCCAGAGTGG + Intergenic
954520073 3:51217164-51217186 TTGGTCAGGATGGCCCAGATAGG + Intronic
955208866 3:56922320-56922342 GAGGTCAGTAACCCACAGACAGG - Intronic
956158344 3:66321844-66321866 TATGACAGAATACCACAGACTGG + Intronic
960056691 3:113280917-113280939 TGGGGGAGGATGCCACTGACTGG - Intronic
961340049 3:126211929-126211951 TAGGTCAGGATGTCAAAAACAGG + Intergenic
961819041 3:129565867-129565889 CAGGTCAGGCTGTGACAGACTGG - Exonic
964691589 3:159455766-159455788 GAGGCCAGGATGCCAGAGTCAGG + Intronic
967682990 3:192386960-192386982 TAGGTAAGGAAGCAACAGACAGG - Intronic
969147231 4:5134541-5134563 TATCACAGAATGCCACAGACTGG - Intronic
969203995 4:5628481-5628503 TATGACAGAATACCACAGACTGG - Intronic
970450706 4:16164416-16164438 GAGGTCAGGAGAACACAGACTGG - Intronic
971652150 4:29292165-29292187 TAGGTCATGAAGCCACAGAATGG + Intergenic
971886554 4:32456848-32456870 TATAACAGGATACCACAGACTGG - Intergenic
976711100 4:88072562-88072584 TAAAGCAGGATGCCACAGAGAGG - Intronic
976855750 4:89603809-89603831 TAGGAAAGTATGCCACACACAGG + Intergenic
977568904 4:98610084-98610106 TATGACAGAATACCACAGACTGG + Intronic
979213660 4:118136701-118136723 TAGTTGAGGATGCCAAAAACGGG - Intronic
979601353 4:122589671-122589693 TAGCTCAGGATTATACAGACTGG + Intergenic
980203957 4:129693659-129693681 TAGGTCAGGGTACCAGACACAGG - Intergenic
981740574 4:147996987-147997009 TATGACAGAATACCACAGACAGG - Intronic
982862390 4:160469613-160469635 ATGGTGATGATGCCACAGACTGG + Intergenic
985297854 4:188454879-188454901 TATATCAGAATGCCACAGACTGG + Intergenic
988422955 5:31028829-31028851 TATAACAGAATGCCACAGACTGG + Intergenic
989407980 5:41083060-41083082 TATAACAGAATGCCACAGACTGG - Intergenic
991088265 5:62668296-62668318 AAGGTCAGGACGCCAAAGGCAGG + Intergenic
991547244 5:67796064-67796086 TATAACAGAATGCCACAGACTGG - Intergenic
992704214 5:79371651-79371673 TAGGTCAGAATCCCACAAAATGG + Intergenic
995926870 5:117385532-117385554 TATGACAAAATGCCACAGACTGG - Intergenic
997270962 5:132537669-132537691 TAGGTCAGCTGGCCACAGGCAGG + Intergenic
997864647 5:137450362-137450384 TGGTGCAGGATGCCACAGAGTGG - Intronic
998656209 5:144182346-144182368 TATAACAGAATGCCACAGACTGG - Intronic
1004306509 6:14506235-14506257 TAGGACAGGAGGCCTAAGACAGG + Intergenic
1005224586 6:23626789-23626811 TATGAGAGAATGCCACAGACTGG - Intergenic
1006422301 6:33942713-33942735 CAGGTCAGGAAGCCAGAGAGAGG - Intergenic
1008141843 6:47840724-47840746 TATAACAGAATGCCACAGACTGG - Intergenic
1009760304 6:67996535-67996557 TAGATCAGAATACCACAGACTGG - Intergenic
1009851493 6:69205501-69205523 TACATCAGAATACCACAGACTGG + Intronic
1010025819 6:71215257-71215279 GAGGTCAGGAGTTCACAGACTGG - Intergenic
1011621955 6:89251445-89251467 CTTGTCAGGATGCCACAGACGGG + Intergenic
1012496157 6:99835694-99835716 TAAAACAGGATACCACAGACTGG - Intergenic
1012612789 6:101236196-101236218 TAAAACAGAATGCCACAGACAGG - Intergenic
1012956100 6:105571893-105571915 TATAACAGGATACCACAGACTGG + Intergenic
1013475876 6:110506866-110506888 TATGACAAAATGCCACAGACTGG - Intergenic
1013981044 6:116129694-116129716 TATAACAGAATGCCACAGACGGG - Intronic
1014314214 6:119843006-119843028 TATAACAGAATGCCACAGACTGG + Intergenic
1018425900 6:163680194-163680216 TGGTTCAAGATGCCACATACAGG - Intergenic
1018873681 6:167802294-167802316 TATGACAGAATTCCACAGACTGG - Intergenic
1018912155 6:168107667-168107689 TGGGTCAGGTTGACACAGTCAGG + Intergenic
1022850449 7:34256231-34256253 TAGGTCAGAATGACACAGTGTGG - Intergenic
1023247377 7:38219574-38219596 TAGTTCAGGATGCTTCAGAGAGG + Exonic
1025664683 7:63575867-63575889 AAGGTCAGGATGGCAGAAACTGG + Intergenic
1026732007 7:72920296-72920318 GATGTCAGGATGCCACACATTGG + Intronic
1029599130 7:101553591-101553613 TGGGTGGGGATGCCACAGAGGGG + Intronic
1029935149 7:104416756-104416778 TACAACAGGAAGCCACAGACTGG + Intronic
1030172050 7:106612743-106612765 TATAACAGAATGCCACAGACTGG - Intergenic
1030925833 7:115453207-115453229 TAGGTCAGGATGTCAAAGTCTGG - Intergenic
1031747141 7:125514022-125514044 TAAGTCAGGTTGTCACACACTGG - Intergenic
1035982277 8:4386035-4386057 GAAGACAGGATGGCACAGACTGG - Intronic
1037393114 8:18415535-18415557 TAGGGCAGGATACCACAGACTGG + Intergenic
1037614752 8:20508664-20508686 AATGTCAGGGTGCCACACACAGG + Intergenic
1038697241 8:29817510-29817532 TATAACAGAATGCCACAGACGGG - Intergenic
1040049248 8:42996056-42996078 TAGGTCATGATGCAACATTCAGG - Intronic
1044108404 8:88240165-88240187 TAGGTGAGTATGACACAGAAAGG - Intronic
1044850704 8:96424697-96424719 TATGACAGAATGCCACAGATTGG + Intergenic
1045822471 8:106356345-106356367 GAAGTCAGGAGGCCATAGACAGG + Intronic
1047250613 8:123179477-123179499 TCTAACAGGATGCCACAGACTGG - Exonic
1048642817 8:136383256-136383278 TAGGTCTGGAAGCCAAAAACCGG + Intergenic
1049249040 8:141578406-141578428 GAGGTGAGGATCCCACAGATGGG + Intergenic
1050190066 9:3015621-3015643 TATATCAGAATACCACAGACTGG + Intergenic
1052869655 9:33491629-33491651 TATAACAGGATACCACAGACTGG - Intergenic
1056133316 9:83606565-83606587 TAAGTCAGTAGACCACAGACAGG + Intergenic
1057134357 9:92676697-92676719 TATGACAGAATACCACAGACTGG + Intergenic
1057827012 9:98379056-98379078 GAGGTAAGAATGACACAGACGGG - Intronic
1061776304 9:132967275-132967297 TATAACAGAATGCCACAGACTGG - Intronic
1062331622 9:136047431-136047453 TGGCTCTGGATGCCACAGTCTGG - Intronic
1062613288 9:137384525-137384547 CACGTAAGGATGCCACAGCCCGG + Intronic
1188753524 X:33932816-33932838 TATGCCAGAATACCACAGACTGG + Intergenic
1189304146 X:39974143-39974165 TGGGTCAGGAGGCCTCAGACTGG - Intergenic
1192796014 X:74424208-74424230 TAGGTCAGGAAGAAACAGAAAGG + Intronic
1193184149 X:78492480-78492502 TAGGTCGGGAAACCACAGAGGGG + Intergenic
1193862798 X:86691778-86691800 TAGCTAAGGCTGCCACAGACAGG - Intronic
1199738255 X:150705988-150706010 TGTGACAGAATGCCACAGACTGG + Intronic