ID: 1074766313

View in Genome Browser
Species Human (GRCh38)
Location 10:116702471-116702493
Sequence CAGCAAATATCAGTGGAGGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 281}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074766313_1074766318 -8 Left 1074766313 10:116702471-116702493 CCGGCCTCCACTGATATTTGCTG 0: 1
1: 0
2: 1
3: 15
4: 281
Right 1074766318 10:116702486-116702508 ATTTGCTGCTCAAATGGGTCTGG No data
1074766313_1074766319 4 Left 1074766313 10:116702471-116702493 CCGGCCTCCACTGATATTTGCTG 0: 1
1: 0
2: 1
3: 15
4: 281
Right 1074766319 10:116702498-116702520 AATGGGTCTGGAATCATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074766313 Original CRISPR CAGCAAATATCAGTGGAGGC CGG (reversed) Intronic
901824514 1:11852020-11852042 CAGGAAATGTCAGTGGAGAGTGG + Intergenic
901906402 1:12415840-12415862 CAGCAGATATCACTGGAACCTGG + Intronic
902872342 1:19322145-19322167 CAGCAAGCATCAGTGGTGGGGGG + Intronic
904789806 1:33010882-33010904 AAGTACATATCAGAGGAGGCTGG + Intronic
908148880 1:61278778-61278800 CAGAACATCTCAGGGGAGGCGGG + Intronic
910354219 1:86336826-86336848 CAGAAAACAGAAGTGGAGGCAGG + Intergenic
912025883 1:105171492-105171514 AAGAAAATAACAGTGTAGGCTGG - Intergenic
915231738 1:154450851-154450873 CAGCCAGCATCAGTGCAGGCAGG - Intronic
916499545 1:165375245-165375267 CAGTAATTAACAGTGGAGGTTGG - Intergenic
916800224 1:168208990-168209012 TAAGAAATATCAGTAGAGGCCGG + Intergenic
916913481 1:169379110-169379132 TAGTAACTATCAGTTGAGGCAGG - Intronic
919766226 1:201129055-201129077 CAGCGAATAGCAGCGGAGCCAGG + Intergenic
921428644 1:215036299-215036321 CAGAGAATTTCAGTGGAGGAAGG - Intronic
922196108 1:223362445-223362467 CAGCAATGAGCAGTGGAGGCAGG + Intronic
1064436779 10:15317687-15317709 TATAAAATATCAGTGCAGGCTGG - Intronic
1064980662 10:21163281-21163303 CAGAAAATAACTGTGGTGGCAGG + Intronic
1068193790 10:53689340-53689362 CAGCAAATATTAATGGATTCAGG + Intergenic
1068221839 10:54055620-54055642 CAGCTAATATCAGAGGTGTCTGG - Intronic
1071082706 10:81831312-81831334 CAGCAAATAGCAGTGGTGGACGG + Intergenic
1071159682 10:82731068-82731090 CAAGAAATATCACTGGAAGCTGG + Intronic
1071814151 10:89214821-89214843 GAGGAAATATCAGTGAAAGCTGG - Exonic
1074150859 10:110758637-110758659 CAGCACATATCATCGGCGGCAGG - Intronic
1074443218 10:113496903-113496925 CAGGAAGTACCAGTGGGGGCGGG - Intergenic
1074766313 10:116702471-116702493 CAGCAAATATCAGTGGAGGCCGG - Intronic
1075045978 10:119147021-119147043 CAGCAAACCCCAGGGGAGGCAGG - Intronic
1076032571 10:127171999-127172021 GTTAAAATATCAGTGGAGGCCGG - Intronic
1076246995 10:128955035-128955057 CAGCAAGTTTCAGGGGAGGTCGG - Intergenic
1076686143 10:132199305-132199327 CAGCAAATAGCAATGTAGGGAGG - Intronic
1076927106 10:133497040-133497062 CAATAAATATCAGTGCAGCCTGG - Intergenic
1076942687 10:133620331-133620353 CAGGACACATCAGTGGAAGCTGG - Intergenic
1077249363 11:1554232-1554254 CAGCAAATAACAGGAGGGGCCGG + Exonic
1077520136 11:3028269-3028291 CAATAAATATCAGTGCAGCCTGG + Intronic
1078297298 11:10086005-10086027 CAAAAGATATAAGTGGAGGCTGG + Intronic
1078375563 11:10790652-10790674 CAGCATATATCTTTGGGGGCTGG + Intergenic
1078643399 11:13116371-13116393 CAGGAGATATTACTGGAGGCAGG - Intergenic
1079069202 11:17328613-17328635 CAGTAAATATCAGCAGTGGCTGG - Intronic
1079282433 11:19099402-19099424 CATAAAATATCTGTGGAGACAGG + Intergenic
1080122926 11:28698088-28698110 CAGCAAATAGCAGTTGAGGCTGG - Intergenic
1080148895 11:29024553-29024575 CAGGAAAGATGAGTGGGGGCCGG - Intergenic
1081069741 11:38595865-38595887 CAGCAAATAGCAGTGGTGGATGG + Intergenic
1081070858 11:38606845-38606867 CAGCAAACAGCAGTGGTGGAAGG - Intergenic
1083774306 11:64886364-64886386 GAGCAAATATTATTGCAGGCCGG + Intronic
1085147010 11:74209652-74209674 CAGGAAACCACAGTGGAGGCAGG + Intronic
1085698318 11:78724551-78724573 CATCATATATCAGTGGAGAATGG - Intronic
1087694127 11:101356163-101356185 CAGCTAAAATCAGTGGAGCAGGG + Intergenic
1087945504 11:104155446-104155468 CTGGAAATATAAGAGGAGGCAGG + Intronic
1088242923 11:107789629-107789651 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1088897117 11:114086971-114086993 CAGGAAATACCAGAGGAGGAGGG - Intronic
1089697904 11:120227053-120227075 CAGCACAGAGCAGTGGAGGAGGG + Intronic
1091325111 11:134680321-134680343 CAGCAAACAGCAGTGGCTGCTGG - Intergenic
1091564855 12:1640758-1640780 CAGCAAAGAAAAGAGGAGGCTGG - Intronic
1092634665 12:10429788-10429810 CATAAAATATCAGTGCTGGCCGG - Intronic
1092635707 12:10445212-10445234 CATAAAATATCAGTGCTGGCCGG - Intronic
1096027425 12:48378985-48379007 CAGAAGATATTAGTGTAGGCTGG - Intergenic
1096568235 12:52499027-52499049 CAGGAAATCTCAGAGGAGACTGG - Intergenic
1097376748 12:58852228-58852250 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1097377757 12:58859357-58859379 CAGCAAACAGCAGTGGTGGGCGG + Intergenic
1098100720 12:67013781-67013803 CAGAAAATATCCCTGGAGGTGGG - Intergenic
1098984869 12:77001448-77001470 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1101052566 12:100878546-100878568 CAGCAACTTTGAGTGAAGGCAGG + Intronic
1101693465 12:107102571-107102593 CAGCAAATGACAGTGTAGACAGG + Intergenic
1101776474 12:107799114-107799136 CAGTAAATATCAGTGCAGCCTGG - Intergenic
1102879420 12:116472802-116472824 CAGGAAGTAGGAGTGGAGGCTGG - Intergenic
1103743819 12:123108869-123108891 CAGCAAGTAACAGTTGAGCCTGG + Intronic
1104878204 12:132051418-132051440 CAATAAATATCAGTGCAGCCTGG - Intronic
1105717705 13:23083862-23083884 CAGCAAATATAAGTGTACGTGGG + Intergenic
1105876095 13:24554716-24554738 CAATAAATATCAGTGTAGCCTGG - Intergenic
1106505181 13:30364871-30364893 CAGTAAAGAACGGTGGAGGCTGG - Intergenic
1106895845 13:34301552-34301574 CAAGAAACATCAGTGGAGGAAGG - Intergenic
1107156430 13:37172407-37172429 CAGCAAACAGCAGTGGCGGAGGG + Intergenic
1110502491 13:76244708-76244730 CAGCATAACTCAGTGGAGGATGG + Intergenic
1111186068 13:84737348-84737370 AAGCAAATGTCTTTGGAGGCAGG + Intergenic
1111910276 13:94303076-94303098 CAGCAAACAGCAGTGGTGGATGG + Intronic
1112601991 13:100865557-100865579 AAGCAAATGTTAATGGAGGCTGG - Intergenic
1113755617 13:112808811-112808833 CTGCACATAGCAGGGGAGGCTGG - Intronic
1113775439 13:112942430-112942452 CAATAAATATCAGTGCAGCCTGG + Intronic
1113880366 13:113622169-113622191 CAATAAATATCAGTGCAGCCTGG + Intronic
1114165737 14:20216639-20216661 CAATAAATATCAGTGCAGCCTGG - Intergenic
1114384823 14:22243779-22243801 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1117674439 14:58141396-58141418 CAGCAAATATCAGACGCTGCTGG - Intronic
1120107987 14:80517978-80518000 CAGCAAACAGCAGTGGTGGACGG + Intronic
1120189680 14:81429260-81429282 CACCAAATGTCAGGGGAAGCAGG + Intronic
1120244018 14:81984434-81984456 CAGCAAGTATCAGTGGCAGGTGG + Intergenic
1120716334 14:87844912-87844934 CAGCAATAATCAAAGGAGGCTGG + Intronic
1120953598 14:90062646-90062668 CAGCTCATGTCAGTGGAGTCTGG - Intronic
1122508176 14:102245492-102245514 AAGGAAATATCAGTTAAGGCAGG - Intronic
1122997191 14:105271648-105271670 CAGCACAGAGCAGAGGAGGCTGG + Intronic
1124020521 15:25918213-25918235 AAGAAAAAATCAGTGGAGGGAGG - Intergenic
1124661877 15:31556345-31556367 AAGCAGAGATCAGTGAAGGCAGG - Intronic
1125714289 15:41810418-41810440 CAGGAGAAAGCAGTGGAGGCTGG + Intronic
1125786225 15:42320742-42320764 CATGAAATATGAATGGAGGCAGG - Intronic
1127245556 15:57169379-57169401 CAGTAAATGTCAGTTGAGGGGGG + Intronic
1128306917 15:66604788-66604810 CAAGAAATATCTGTCGAGGCCGG + Intronic
1128582855 15:68820983-68821005 CAGCCAATGGCAGTGGCGGCGGG + Intronic
1128641865 15:69344797-69344819 TATGAAATATGAGTGGAGGCTGG + Intronic
1129923306 15:79339294-79339316 CAATAAATATCAGTGCAGCCTGG + Intronic
1131274342 15:90968370-90968392 CAGCAATTAAGAGGGGAGGCAGG + Intronic
1131420109 15:92298265-92298287 CAGCAAATAGCAGTGGTGGACGG - Intergenic
1133175580 16:4011490-4011512 CAGGAAATAACAGTGGAAACGGG + Intronic
1133206147 16:4235013-4235035 CAGCTCATTGCAGTGGAGGCTGG - Intronic
1135461025 16:22643022-22643044 CAGCTAATATCAGGGCAGGTGGG + Intergenic
1135695643 16:24583899-24583921 CAAAAAATATGAGTGGAGGGTGG - Intergenic
1136737802 16:32478488-32478510 CAGCAAAAATCCGCGGCGGCAGG + Intergenic
1137564493 16:49524735-49524757 CAGCAGATGTCGGGGGAGGCAGG + Intronic
1138510903 16:57507938-57507960 CAGTCAATGTCAGTGAAGGCGGG + Intergenic
1139731938 16:68953376-68953398 CAATAAATATCTGTTGAGGCGGG - Intronic
1140879877 16:79188266-79188288 AAGGAAATGTCGGTGGAGGCAGG + Intronic
1141298453 16:82791595-82791617 CAGCAAACAACAGTGGTGGATGG - Intronic
1142228696 16:88889381-88889403 CAGGAAAAAGCAGAGGAGGCAGG + Intronic
1142368879 16:89666687-89666709 CAATAAATATCAGTGCAGCCTGG - Intronic
1203015271 16_KI270728v1_random:351089-351111 CAGCAAAAATCCGCGGCGGCAGG - Intergenic
1203033606 16_KI270728v1_random:624247-624269 CAGCAAAAATCCGCGGCGGCAGG - Intergenic
1142587470 17:982601-982623 CAATAAATATCAGTGCAGCCTGG + Intergenic
1145223414 17:21107592-21107614 CAATAAATATCAGTGCAGCCTGG - Intergenic
1146103858 17:30012601-30012623 CAATAAATATCAGTGCAGCCTGG + Intronic
1146356051 17:32135216-32135238 CAATAAATATCAGTGCAGCCTGG - Intergenic
1146747268 17:35343317-35343339 AAGAAAATATTATTGGAGGCTGG - Intergenic
1147339304 17:39744409-39744431 CAGCAAATAGAAGTAGAGCCAGG - Intronic
1148226996 17:45906073-45906095 CAGACAAGATCAGTGCAGGCTGG - Intronic
1148229740 17:45924439-45924461 CAGCAAAGAGGAGTGGAGGCCGG - Intronic
1149389134 17:56171964-56171986 CAGCAAATACCAAAGGATGCTGG - Intronic
1153400773 18:4682045-4682067 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1155590852 18:27425461-27425483 TAGCAAAAAACAGGGGAGGCAGG + Intergenic
1156088359 18:33436715-33436737 CACCTAATTTCAGTGGAGCCTGG + Intronic
1161179734 19:2871829-2871851 CAATAAATATCAGTGCAGCCTGG - Intronic
1161530468 19:4785994-4786016 CAATAAATATCCGTGGAAGCTGG - Intergenic
1161650702 19:5482756-5482778 CAGCAAATGTCAGACTAGGCTGG - Intergenic
1163885151 19:19958850-19958872 CAATAAATATCAGTGCAGCCTGG - Intergenic
1164173170 19:22745520-22745542 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1164389040 19:27801989-27802011 CAATAAATATCAGTGCAGCCTGG - Intergenic
1165163942 19:33837650-33837672 GAGAAAATATAAGAGGAGGCGGG + Intergenic
1166321931 19:42023980-42024002 CAGAAGATATGAGGGGAGGCTGG - Intronic
1166453717 19:42922782-42922804 CAATAAATATCAGTGCAGCCTGG - Intronic
1166762069 19:45231216-45231238 CAGCAAACATCACTGTAGCCGGG + Intronic
1167979164 19:53258474-53258496 CAATAAATATCAGTGCAGCCTGG + Exonic
1168234925 19:55056648-55056670 CAGCAAAGATCATTGAAGGTAGG - Exonic
1168330360 19:55564368-55564390 CAGCAAATATTTATGGAGCCAGG + Intergenic
925023807 2:592583-592605 CAGCAAACAGCAGTGGTGGAGGG - Intergenic
925255309 2:2480522-2480544 CAGGAAATCTCAGTGGAGAAGGG - Intergenic
925941010 2:8818766-8818788 CAGCTATCATCAGTGGAGTCTGG + Exonic
928547058 2:32337922-32337944 AAGAAAATACCAGTTGAGGCCGG - Intergenic
930115763 2:47717026-47717048 CAATAAATATCAGTGCAGCCTGG + Intronic
930895831 2:56444837-56444859 CAGCAAATATCCAGGGAGACAGG + Intergenic
931151256 2:59576144-59576166 CATAAAATCTCAGTGGAGGTCGG + Intergenic
932705377 2:74020604-74020626 CAGCAGAGACCAGTGGGGGCAGG - Intronic
934188925 2:89767602-89767624 CAGCAAAAATCCGCGGCGGCGGG + Intergenic
934307662 2:91840353-91840375 CAGCAAAAATCCGGGGCGGCGGG - Intergenic
934543603 2:95196308-95196330 CAGCTAATATTAGTAGAGGCGGG + Intergenic
935677866 2:105611173-105611195 CAGCATATTTCAGAGGAAGCTGG + Intergenic
935748347 2:106209327-106209349 CAGCAAACAGCAGTGGTGGATGG - Intergenic
937658646 2:124405442-124405464 CTGCATATATAAGTGGAGTCCGG - Intronic
940845594 2:158638495-158638517 CAGCAAATGCCAAGGGAGGCAGG - Intronic
941399196 2:165009936-165009958 CAGCAAGTGACTGTGGAGGCAGG + Intergenic
941759547 2:169226353-169226375 AAGAAAACATCAGTGCAGGCAGG + Intronic
941928257 2:170916784-170916806 CAATAAATATCAGTGCAGTCTGG + Intergenic
944558239 2:200908514-200908536 TATAAAAGATCAGTGGAGGCCGG - Intergenic
945582845 2:211617983-211618005 CAGCAAATTTCAGAGTAGGATGG - Intronic
946581470 2:221132790-221132812 TAGAAAATCTAAGTGGAGGCTGG - Intergenic
947198675 2:227595641-227595663 CAGCAAATACCCGTGGAGTGAGG + Intergenic
948147160 2:235716447-235716469 CAGATAATTTGAGTGGAGGCAGG + Intronic
948217254 2:236240828-236240850 CAGCCAGCATCAGTAGAGGCAGG - Intronic
949019303 2:241732228-241732250 CAATAAATATCAGTGCAGCCTGG - Intergenic
1171448362 20:25220205-25220227 CAGCAAACAGCAGTCGCGGCTGG + Intronic
1172180355 20:32999730-32999752 CAGTATATGTCAGTGGAGGGAGG + Intronic
1172537769 20:35687554-35687576 CAATAAATATCAGCGCAGGCTGG + Intronic
1174520121 20:51122853-51122875 CAGCTAATAATAGTGGAGCCAGG - Intergenic
1175077077 20:56384768-56384790 CAGCTAATATAAATGGAGGGTGG - Intronic
1176742505 21:10616904-10616926 CAGCAAAAATCCGCGGCGGCGGG - Intergenic
1177133015 21:17279956-17279978 AAGGAAATATCAGTGGTGTCTGG + Intergenic
1177263980 21:18760153-18760175 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1179444728 21:41423260-41423282 CAGCAAATGGCAGTGGTGGATGG + Intronic
1181588232 22:23866256-23866278 CACCCAATGTCAGGGGAGGCTGG + Intronic
1184178124 22:42801399-42801421 CAGCAAACATCAGTTGTGGGTGG - Intronic
1184915203 22:47564184-47564206 CAGCAGATGTCGGTGGAAGCCGG + Intergenic
1185009111 22:48303254-48303276 CAGCAAATGTAGGCGGAGGCTGG - Intergenic
1185342360 22:50297298-50297320 CAGCCAAGGTCAGGGGAGGCTGG + Intronic
949811676 3:8012972-8012994 CAGCAAACAGCAGTGGTGGATGG + Intergenic
949873815 3:8611123-8611145 CAGGAACTGTCAGAGGAGGCTGG - Intergenic
951016256 3:17735811-17735833 CAGCAAACAGCAGTGGTGGATGG + Intronic
951578789 3:24140403-24140425 CATCAAATGGCAGTAGAGGCTGG + Intronic
952240032 3:31521938-31521960 CAGGAAATATCAGTAGGGGAAGG - Intergenic
955701357 3:61685193-61685215 TTGGAATTATCAGTGGAGGCAGG + Intronic
955820312 3:62889576-62889598 CAAAAAATATCAGTGGATGTTGG + Intergenic
957000509 3:74877945-74877967 CAGCAAACAGCAGTGGTGGATGG + Intergenic
957687039 3:83515284-83515306 CAGCAAACAGCAGTGGTGGACGG - Intergenic
958657247 3:97018412-97018434 CAATAAATATCAGTGCAGCCTGG - Intronic
961749009 3:129084756-129084778 CAGCACATGGCAGAGGAGGCCGG - Intergenic
961775359 3:129280016-129280038 CAGAATATATCAGTAAAGGCTGG - Intronic
965439746 3:168698576-168698598 CAATAAATATCAGTGCAGTCTGG - Intergenic
965670593 3:171143727-171143749 CAACAAATATCACTGGTGGCTGG - Intronic
965827476 3:172745367-172745389 CAAAAAATATCTATGGAGGCTGG - Intergenic
966572129 3:181455588-181455610 GAGCAAATCTATGTGGAGGCAGG + Intergenic
966815600 3:183887341-183887363 CAATAAATATCAGTGCAGCCTGG + Intergenic
968667904 4:1831307-1831329 CCGCAGATGTCTGTGGAGGCTGG - Intronic
969519087 4:7665384-7665406 CAGCAGAGAGCAGTGGAGACTGG - Intronic
971066347 4:23036865-23036887 CAGTAAATATCTGTGGAGGGTGG + Intergenic
972703546 4:41517295-41517317 CAGCAAATTGCAAAGGAGGCTGG + Intronic
974487853 4:62526898-62526920 CAGCAAACAGCAGTGGTGGACGG + Intergenic
974493436 4:62595955-62595977 CAATAAATATCAGTGCAGCCTGG + Intergenic
975378408 4:73671025-73671047 CAATAAATATCAGTGCAGCCTGG - Intergenic
975418825 4:74138679-74138701 CAGCAAACAGCAGTGGTGGATGG + Intronic
976515229 4:85956792-85956814 CAGCAAAAAGCAGTGGTGGATGG + Intronic
977641515 4:99362649-99362671 AAGCAAGTATGAGTGTAGGCTGG + Intergenic
977647898 4:99435028-99435050 CAGAGAATGTCAGTGGAAGCAGG - Exonic
977742639 4:100505169-100505191 CAGTAAATATCAGTGCAGCCTGG + Intronic
980190519 4:129519325-129519347 CAGCAAACAGCAGTGGTGGACGG - Intergenic
980523646 4:133961712-133961734 CAGCAAACAGCAGTGGTGGACGG - Intergenic
984223572 4:177007015-177007037 CATAAAATATCACTGGATGCTGG + Intergenic
985023566 4:185716826-185716848 GAGGAAACATCAGTGGAGGGAGG + Intronic
988373961 5:30408988-30409010 TAGAGAATATCAGTGGAGACAGG + Intergenic
989717696 5:44483491-44483513 CAGCAAATAGCAGTGGTGGACGG - Intergenic
991029280 5:62066040-62066062 CTGAAAACATCTGTGGAGGCTGG + Intergenic
991649206 5:68834543-68834565 CACCAGACGTCAGTGGAGGCTGG + Intergenic
991771837 5:70048289-70048311 CAAGAAATATCTGTGGAGGAAGG - Intergenic
991851128 5:70923697-70923719 CAAGAAATATCTGTGGAGGAAGG - Intergenic
992699848 5:79330892-79330914 AAGTAAATATCAGCTGAGGCTGG + Intergenic
992795532 5:80252354-80252376 CAGAAAATGACAGTGCAGGCTGG - Intronic
993788781 5:92179635-92179657 AAGCAAATATCTTTGGAGGATGG - Intergenic
997214287 5:132097435-132097457 CAGCAAATCTCAGTGGTGTGGGG + Intergenic
997375728 5:133395854-133395876 CAGGAAATGCCAGTGGAGCCTGG - Intronic
997384751 5:133463871-133463893 CAGCAAAGTTAGGTGGAGGCTGG + Intronic
997853527 5:137353890-137353912 CAGCAAGTATCTGTAGAGGGAGG - Intronic
999451564 5:151682129-151682151 CAGGAAATAGAAGTGGAAGCAGG - Intronic
1001199645 5:169704513-169704535 CAGCTAATATGAGGGGAGGCTGG - Intronic
1003991382 6:11490062-11490084 CAGTAATCATCAGTGGAGGAGGG + Intergenic
1004236359 6:13878455-13878477 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1005098286 6:22142299-22142321 CAAAAAATAGCAGGGGAGGCAGG - Intergenic
1006775925 6:36592558-36592580 CAGTAACTAGCAGTGGGGGCTGG + Intergenic
1006830217 6:36963911-36963933 CAGCCAACACCAGAGGAGGCAGG - Exonic
1006877230 6:37308377-37308399 CAGCAAAAAGCAGTGGAGAAAGG - Intronic
1008142082 6:47843648-47843670 CAGCAAATCACAGTGGAGAGAGG - Intergenic
1010662264 6:78584923-78584945 CAGCAAATTACAGTGGAGACTGG + Intergenic
1012077561 6:94710858-94710880 GAGCAATTATCAGTGGTGGTTGG + Intergenic
1012480544 6:99662179-99662201 TAGCAAATTGCAGTGTAGGCTGG - Intergenic
1012889664 6:104884053-104884075 CAGCAAATATCACTGAAGCTTGG - Intergenic
1014737939 6:125116854-125116876 CAGCTAATAACAGTGGAGATGGG - Intergenic
1015632764 6:135247944-135247966 CAGCAAACAGCAGTGGTGGACGG - Intergenic
1016421932 6:143893980-143894002 AAGAAAATACCAGTGCAGGCCGG - Intronic
1016689624 6:146922056-146922078 CAGCTAATATAGATGGAGGCAGG + Intergenic
1017715354 6:157207162-157207184 CAGCAAAGATGAGTGGTGGTGGG + Exonic
1018177215 6:161187466-161187488 CAGCAAAAATCAGTTAAGGATGG + Intronic
1018971816 6:168535264-168535286 CATAAAATATCTCTGGAGGCTGG - Intronic
1019109390 6:169697808-169697830 CAATAAATATCAGTGCAGCCTGG + Intronic
1020404424 7:7815907-7815929 CAATAGATATCAGTGGAGGTGGG + Intronic
1021455051 7:20820519-20820541 CAGTAAATATTTGTTGAGGCCGG - Intergenic
1024148021 7:46536784-46536806 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1024215428 7:47244386-47244408 CAGTAAAGATCTGTTGAGGCAGG + Intergenic
1025320207 7:58087328-58087350 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1025609822 7:63068272-63068294 CAGGAAACATGAGAGGAGGCGGG - Intergenic
1026351736 7:69522362-69522384 CAAAAATTATCACTGGAGGCTGG - Intergenic
1029277410 7:99415193-99415215 CAATAAATATCAGTGCAGCCTGG - Intronic
1029699634 7:102237800-102237822 CAATAAATATCAGTGCAGCCTGG - Intronic
1033028341 7:137800009-137800031 AAGCAAATACCAGGGGTGGCAGG + Intronic
1033592013 7:142816882-142816904 CAGCAGATATCAGTGGGGACAGG + Intergenic
1034707081 7:153155210-153155232 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1037522539 8:19693779-19693801 TAGCAGATACCAGTGGAGACTGG - Intronic
1037775674 8:21834008-21834030 GAGCAAATGTGGGTGGAGGCTGG + Intergenic
1038755770 8:30339576-30339598 CAGGAAAGATCTGTGGGGGCTGG - Intergenic
1040104975 8:43536394-43536416 CAATAAATATCAGTGCAGCCTGG - Intergenic
1040500870 8:48003940-48003962 CAGGAGGTATCAGTGGAGGCTGG + Intergenic
1044082633 8:87904194-87904216 CAGCAAATATTGATGGAGTCTGG - Intergenic
1045664320 8:104468926-104468948 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1046088793 8:109473213-109473235 CAGAAAACTTCACTGGAGGCTGG + Intronic
1046663001 8:116969102-116969124 CAGCAAGTAACACTGGAGGTGGG - Intronic
1047276649 8:123410761-123410783 CAGCAAACAGCAGTGGTGGACGG - Intronic
1048898822 8:139018750-139018772 CAGCACAGAACAGAGGAGGCAGG - Intergenic
1049458704 8:142709931-142709953 CAATAAATATCAGTGCAGCCTGG - Intergenic
1049575425 8:143387644-143387666 AAGAAAAAAACAGTGGAGGCCGG - Intergenic
1049636833 8:143693589-143693611 CAGCAAAGCCCAGAGGAGGCCGG - Intronic
1049666270 8:143844646-143844668 CAATAAATATCAGTGCAGCCTGG + Intergenic
1049880077 8:145055937-145055959 CAATAAATATCAGTGCAGCCTGG + Exonic
1050130890 9:2410870-2410892 CATTAAATATTAATGGAGGCTGG - Intergenic
1051699196 9:19801422-19801444 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1052591218 9:30497938-30497960 CAGCACAGCTCAGGGGAGGCAGG + Intergenic
1053233919 9:36434971-36434993 CTGCAACTATAAGTGGAGGGTGG + Intronic
1055419279 9:76120828-76120850 CAGGAAATAATAGTAGAGGCAGG - Intronic
1056705015 9:88944283-88944305 CAGCAAACAGCAGTGGTGGTTGG + Intergenic
1058159184 9:101549189-101549211 CAATAAATATCAGTGCAGCCTGG - Intronic
1060759488 9:126235469-126235491 CAACAGAAATCAGGGGAGGCAGG - Intergenic
1060874186 9:127068351-127068373 GAGCAAATAGCTGTGGATGCAGG + Intronic
1062645535 9:137546326-137546348 CAATAAATATCAGTGCAGCCTGG + Intronic
1203612989 Un_KI270749v1:27065-27087 CAGCAAAAAGCCGTGGCGGCGGG - Intergenic
1186465105 X:9779006-9779028 GAGCAGAAAACAGTGGAGGCTGG - Intronic
1188073401 X:25745708-25745730 CAGCAAATGACAGTTGTGGCTGG - Intergenic
1190135510 X:47793000-47793022 CCTCAAAAATCAGTTGAGGCTGG - Intergenic
1192397326 X:70795169-70795191 CAGTGAACATCAGTGGAGCCTGG + Intronic
1192580537 X:72277426-72277448 CAGCAAATATGGGAGGAGGAAGG - Intronic
1192853931 X:74987161-74987183 CAGCAAACAGCAGTGGTGGACGG + Intergenic
1192960997 X:76130737-76130759 CAGCAAACAGCAGTGGTGGATGG - Intergenic
1193127824 X:77888104-77888126 TAACAACTATTAGTGGAGGCCGG - Intronic
1193172388 X:78350375-78350397 CAGCAAACAGCAGTGGTGGATGG + Intergenic
1195584602 X:106551389-106551411 CAGCAAACAGCAGTGGTGGTCGG - Intergenic
1195763422 X:108271463-108271485 AAGTAAATATGAGTGCAGGCAGG + Intronic
1196366880 X:114933475-114933497 CAGCAGAAATCAGCGGAGGTTGG - Intergenic
1198287577 X:135207142-135207164 CAATAAATATCAGTGCAGCCTGG + Intergenic
1198344665 X:135747735-135747757 CAAGAAATATCAGTGCAGCCTGG - Intergenic
1200412706 Y:2877287-2877309 CAATAAATATCAGTGTAGCCTGG + Intronic
1201708187 Y:16959761-16959783 CAACAAATACCAGTGCAGCCTGG + Intergenic