ID: 1074767061

View in Genome Browser
Species Human (GRCh38)
Location 10:116707248-116707270
Sequence CTGCATATTCATCTCCAGCC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 222
Summary {0: 1, 1: 0, 2: 0, 3: 30, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074767061_1074767066 28 Left 1074767061 10:116707248-116707270 CCGGGCTGGAGATGAATATGCAG 0: 1
1: 0
2: 0
3: 30
4: 191
Right 1074767066 10:116707299-116707321 CAAAGCCGCCTCCTTAGAAGTGG 0: 1
1: 0
2: 0
3: 8
4: 84
1074767061_1074767064 0 Left 1074767061 10:116707248-116707270 CCGGGCTGGAGATGAATATGCAG 0: 1
1: 0
2: 0
3: 30
4: 191
Right 1074767064 10:116707271-116707293 ATGTGGGAGCCGTTTCTGAAAGG 0: 1
1: 0
2: 0
3: 7
4: 94

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074767061 Original CRISPR CTGCATATTCATCTCCAGCC CGG (reversed) Exonic
900345292 1:2207591-2207613 CTGCATCTCCAGCTCCTGCCAGG - Intronic
900482237 1:2904954-2904976 CTGAATATTCATGCCCAGCCAGG - Intergenic
900505345 1:3027598-3027620 CTGCAGACTCATCTCCACCAGGG + Intergenic
900519199 1:3097610-3097632 CTGCCCTCTCATCTCCAGCCTGG + Intronic
902902917 1:19532538-19532560 CTGAATCTTCCTCCCCAGCCAGG - Intergenic
904688575 1:32276915-32276937 CTGGAGACTCACCTCCAGCCGGG + Intronic
904807754 1:33143645-33143667 GTGGATCTTCATCTACAGCCTGG - Intergenic
905061403 1:35142697-35142719 CAGCATATTCGTATCCAGCAAGG + Intergenic
906296211 1:44650560-44650582 CTGCCTATGCGTCCCCAGCCTGG + Intronic
909080511 1:71105827-71105849 CTGCATACTCTTCACCATCCTGG - Intergenic
909399153 1:75207057-75207079 CTTCCTATTCAGCTCCATCCCGG - Intronic
910396662 1:86800539-86800561 CTGCATTTTTCTCTGCAGCCTGG - Intergenic
911709686 1:101055937-101055959 CTCCATATTCATCTCTTGCATGG - Intergenic
912455611 1:109794829-109794851 CTGCCTCCTCATCTGCAGCCTGG - Intergenic
912808538 1:112775494-112775516 GTGCATTTCCAGCTCCAGCCAGG + Intergenic
913074032 1:115326027-115326049 CCGGATGTTCATTTCCAGCCTGG - Intronic
914672205 1:149879467-149879489 CTGCATTTTCATATGAAGCCTGG - Intronic
916102538 1:161405449-161405471 CAGCATATTCATATCCAGCAAGG + Intergenic
918829510 1:189375072-189375094 CTGCTTATTCAGCTCACGCCTGG + Intergenic
923672205 1:236050506-236050528 CTGCACATTGCACTCCAGCCTGG + Intronic
924207214 1:241725614-241725636 GTGCATTTTCCTCTCTAGCCTGG - Intronic
1062906731 10:1184629-1184651 CTGCTTCTGCAGCTCCAGCCTGG + Intronic
1063077420 10:2731043-2731065 CTGCATGTTCCCCTCCAGGCTGG + Intergenic
1063939711 10:11115112-11115134 CTGCATATTAATCTGCATCCTGG - Intronic
1065239637 10:23693576-23693598 TTGCACATTCTGCTCCAGCCGGG + Intergenic
1067133217 10:43585033-43585055 TGGCATATTCATATCCAGCAAGG + Intergenic
1067382730 10:45789867-45789889 CTACATTGTCAGCTCCAGCCAGG - Intronic
1067890433 10:50130412-50130434 CTACATTGTCAGCTCCAGCCAGG - Intronic
1068388119 10:56358933-56358955 CTGCAGATGCTTCTCCTGCCAGG + Exonic
1069999076 10:72362716-72362738 CTGATTATAAATCTCCAGCCTGG + Intergenic
1071181067 10:82984428-82984450 CTTCATATTCATCCCCAGGCAGG + Intronic
1071334180 10:84588276-84588298 CTGCAAATGCATCTCCATCTGGG - Intergenic
1074463735 10:113663871-113663893 CTGCACATTCATCTCGAAGCCGG + Exonic
1074767061 10:116707248-116707270 CTGCATATTCATCTCCAGCCCGG - Exonic
1075312587 10:121427163-121427185 GTGCATCTTGATTTCCAGCCTGG + Intergenic
1077336567 11:2007602-2007624 CTGGAAATTCATGTCCACCCAGG - Intergenic
1078141745 11:8698246-8698268 CTCCATCTTCAGCTCCAGGCAGG + Intronic
1078707618 11:13760336-13760358 CATCAGAGTCATCTCCAGCCAGG - Intergenic
1080575409 11:33594413-33594435 CTGCTTATGCATCTCCAGTCAGG + Intronic
1081512085 11:43785294-43785316 CAGCATATTCATATCTAGCAAGG + Intronic
1083684571 11:64368700-64368722 CTGCGTGTTCGCCTCCAGCCTGG - Exonic
1084390374 11:68871848-68871870 CAGCATATTCATATCCAGCAAGG - Intergenic
1084751600 11:71207871-71207893 CGGCATTTTGCTCTCCAGCCTGG - Intronic
1086156072 11:83667357-83667379 CTGCATATTCACCACCCTCCAGG - Intronic
1087069312 11:94061274-94061296 CCCCATGTTTATCTCCAGCCAGG - Intronic
1087738575 11:101861915-101861937 CAGCAAATTCAACTCCAGCCTGG + Intronic
1202819551 11_KI270721v1_random:62784-62806 CTGGAAATTCATGTCCACCCAGG - Intergenic
1092014752 12:5149422-5149444 CTGGAAATTTATCTGCAGCCGGG + Intergenic
1094612927 12:32010935-32010957 CTGAATATTGCTCTCCAGCCAGG - Intergenic
1098001131 12:65944532-65944554 CTGCTCACTCCTCTCCAGCCTGG - Intronic
1098605670 12:72387081-72387103 CTAAATTTTCATCTCCAGCCTGG + Intronic
1101571632 12:105959015-105959037 ATGCCAATGCATCTCCAGCCTGG + Intergenic
1103914838 12:124370851-124370873 TTGCAAATTCCTCTCCAGCTGGG - Intronic
1103967887 12:124651902-124651924 CTCCAGATTGATCTCCAGCTGGG + Intergenic
1110119646 13:71865959-71865981 CTGCAAACTCATCTCCAGGAAGG - Exonic
1111716729 13:91887743-91887765 CCTCATCTCCATCTCCAGCCTGG + Intronic
1113533332 13:111045273-111045295 CTGCATCTACATCTGCAGCCAGG + Intergenic
1114574154 14:23697235-23697257 CAGCATATTCATATCCAGCAAGG - Intergenic
1115356337 14:32452353-32452375 CTGCATATTAATCCACTGCCTGG + Intronic
1117703367 14:58437751-58437773 CTGCATCTTAATTTCCAGCTTGG - Intronic
1119380964 14:74227888-74227910 CAGCATCCTCATCACCAGCCTGG + Intergenic
1119962032 14:78869629-78869651 TTTCATATTCATCTCCAACAGGG + Intronic
1120726858 14:87953220-87953242 CTGTATAATTACCTCCAGCCAGG + Intronic
1124129557 15:26971770-26971792 CTGCTTTTTCCTCTGCAGCCGGG + Intronic
1126408705 15:48349731-48349753 CTGCGTCTTCACCTCCAGCAGGG + Intergenic
1126702564 15:51381168-51381190 CTGAATATACAGCTTCAGCCGGG + Intronic
1127299020 15:57634430-57634452 CTGCAAACTCATATGCAGCCAGG - Intronic
1127920921 15:63493517-63493539 CTGCCTGTTTCTCTCCAGCCTGG - Intergenic
1128015932 15:64346751-64346773 CTGAAAACTCATTTCCAGCCAGG - Intronic
1129672846 15:77616634-77616656 CTGCAAATCCAAATCCAGCCTGG + Intronic
1129847084 15:78772962-78772984 CTGCTTAGCCATCTCCAGGCTGG + Intronic
1132467292 16:83234-83256 CTGCATGAACATCTCCAGCCAGG + Exonic
1132684016 16:1154715-1154737 CTGCCTCTTCCTCTCCAGCCAGG - Intronic
1133482816 16:6187621-6187643 CTGTATCCTGATCTCCAGCCTGG - Intronic
1134008494 16:10834224-10834246 CTCTATCTTCCTCTCCAGCCCGG + Intergenic
1135673486 16:24394425-24394447 CTGCATATTCAGCAGCAGCAGGG - Intergenic
1135770803 16:25217071-25217093 CGGCATCTTCCTCTCCAGGCTGG + Intronic
1136288907 16:29260038-29260060 CTGCATGGCCACCTCCAGCCGGG + Intergenic
1137268997 16:46890415-46890437 CTTCTTATTCTTCACCAGCCTGG + Intronic
1141781440 16:86164440-86164462 CCGCATATTAACCTCCAGGCTGG + Intergenic
1142094635 16:88232945-88232967 CTGCATGGCCACCTCCAGCCGGG + Intergenic
1146268193 17:31467023-31467045 CTCCATTTTCTTCTCCAGACAGG - Intronic
1146338277 17:31994636-31994658 CAGGATATTCATCGCCAACCTGG + Exonic
1146978794 17:37140455-37140477 ATGCATATTGATCTGTAGCCAGG - Intronic
1147599284 17:41735734-41735756 CTACATTTAAATCTCCAGCCCGG - Intergenic
1149567424 17:57649996-57650018 CTGGAATTTCATCTCCACCCTGG - Intronic
1149664257 17:58354700-58354722 CAGCAAATCCATGTCCAGCCAGG - Exonic
1150113020 17:62518919-62518941 CTGCACATTGCACTCCAGCCTGG - Intronic
1150289357 17:63972710-63972732 CTGCTTATTCCGCTGCAGCCGGG + Exonic
1150413103 17:64963447-64963469 CTGCATATACATCTCAGGCAAGG - Intergenic
1153284865 18:3448426-3448448 CAGCTGATTCATCTGCAGCCAGG + Intronic
1157842713 18:50974439-50974461 CAGCATACCCATCTCCAACCCGG + Exonic
1158626793 18:59078551-59078573 CTGCAGATCCATTTCCAGCGTGG - Intergenic
1159541637 18:69784920-69784942 CTGCATTTTCAGCACCAGCATGG - Intronic
1160220144 18:76970036-76970058 CTGCATATGCGGCTACAGCCAGG - Exonic
1160310026 18:77780491-77780513 CTCCATGCTCACCTCCAGCCCGG + Intergenic
1162039769 19:7963710-7963732 GTGCATTTTCATCTACAACCTGG - Exonic
1163953817 19:20615439-20615461 CAGCATATTCATATCCAGCAAGG - Intronic
1164691801 19:30216745-30216767 CTGCACATTGCACTCCAGCCTGG + Intergenic
1167999780 19:53435774-53435796 CAGCATGTTCATATCCAGCAAGG + Intronic
1168004207 19:53473087-53473109 CAGCATGTTCATATCCAGCAAGG + Intronic
1168419839 19:56194337-56194359 CTGCAAATTTCCCTCCAGCCTGG - Intronic
925593852 2:5536240-5536262 CTGGACACTCCTCTCCAGCCTGG - Intergenic
926291872 2:11538170-11538192 CTGCACCTTCATCGCCAGGCAGG - Intronic
926884822 2:17587238-17587260 CTGCATATCCAGCTCCTCCCAGG - Intronic
928598766 2:32883412-32883434 CTGCAGATCCAACTCCAGACTGG + Intergenic
928812509 2:35246794-35246816 ATGCATATTAATCTCCCTCCGGG - Intergenic
929971272 2:46579394-46579416 CTGGATTTCCATCTCCAGCCTGG + Intronic
930392153 2:50775164-50775186 CTGCATTTCAATCTCCATCCAGG + Intronic
930497215 2:52160961-52160983 CTGCTTATTCATCTCTTGTCAGG + Intergenic
932857320 2:75249743-75249765 CAGCATATTCATTTACAGCATGG - Intergenic
933590952 2:84231760-84231782 CTGCGTTTTCATCTCCAGCAGGG + Intergenic
937036509 2:118786706-118786728 TTGCCTGTGCATCTCCAGCCAGG - Intergenic
937744813 2:125399294-125399316 CTACATATTCATCCCAGGCCAGG - Intergenic
938106020 2:128530329-128530351 CTGCATCCTCATCACCATCCAGG - Intergenic
940085829 2:149857492-149857514 CTGCAAATCCTTCTCCAGCTTGG + Intergenic
944143302 2:196480073-196480095 CTGTATATTCTTCCCCAACCAGG + Intronic
946694470 2:222340321-222340343 CTGCTTTTTCATCTCCTGCTTGG - Intergenic
947089544 2:226494892-226494914 CTGCATCTTCATTTCCAGCAGGG + Intergenic
1169376054 20:5067365-5067387 TGGCATATTCATCTGCAGCGTGG - Intergenic
1170629399 20:18055323-18055345 TTGCATATTTATCACCAGGCTGG - Intronic
1171132172 20:22663830-22663852 CTGAATACACATCCCCAGCCTGG - Intergenic
1173639577 20:44591286-44591308 CTCCAGACTCAACTCCAGCCAGG - Intronic
1175628147 20:60506848-60506870 CAGCATGTTCATTTCCATCCAGG + Intergenic
1175998335 20:62821206-62821228 CTCCATACTCACCCCCAGCCCGG - Exonic
1179143722 21:38749750-38749772 CTGCATGTCCAGCTCCTGCCGGG + Intergenic
1182470504 22:30545179-30545201 GTGCATTTTCGTCTCTAGCCTGG - Intronic
1182692711 22:32175206-32175228 TTGCATTTTCATCTCCTGCCTGG + Intergenic
1184246038 22:43236212-43236234 CTGCCTGTGCCTCTCCAGCCAGG + Intronic
1184438716 22:44496191-44496213 CTGCATATTCATGTGCAGAGTGG + Exonic
1184552574 22:45212372-45212394 CTGCTGATTCATCCCCAGGCTGG - Exonic
949744229 3:7269637-7269659 ATGCATGTACATCACCAGCCTGG - Intronic
950762362 3:15243352-15243374 CTGCATCTTCATTTGGAGCCAGG - Intronic
954512152 3:51134869-51134891 CTACTTTTTCATCTCAAGCCAGG + Intronic
961863674 3:129938061-129938083 CCGTATACTCATCTCCACCCTGG + Intergenic
962197862 3:133379369-133379391 CTGCCTCTTCCTCTGCAGCCAGG - Intronic
963293624 3:143520024-143520046 CCAAATATACATCTCCAGCCTGG - Intronic
966270405 3:178097897-178097919 CTGCATTTGCTTCTCCTGCCAGG - Intergenic
968224698 3:196966529-196966551 TTTGAGATTCATCTCCAGCCTGG + Intronic
970990833 4:22211073-22211095 ATTCATCTTCATCTCCTGCCTGG + Intergenic
973168908 4:47114048-47114070 CTGCATATGCATCTCTAGCTTGG - Intronic
973343750 4:49031993-49032015 CTGAAGGTACATCTCCAGCCTGG - Intronic
973889829 4:55357747-55357769 CTGCCTCTGCAACTCCAGCCTGG - Intronic
974615977 4:64283276-64283298 CTGAGTATTAATCTCCATCCTGG + Intronic
976520842 4:86024084-86024106 CTACATAATCAACTCCAGCCAGG - Intronic
976727843 4:88232094-88232116 ATGCCTATTTAACTCCAGCCTGG - Intergenic
979099180 4:116593549-116593571 CTCCATCTTCAACTCCAGCAGGG + Intergenic
982354237 4:154449145-154449167 CCTCATCTTCTTCTCCAGCCAGG - Intronic
982363359 4:154548412-154548434 CTACATATCCAGCTCCAGTCTGG - Intronic
985558803 5:571103-571125 CTGCATAGTCAGCCCCAGCCTGG + Intergenic
985711420 5:1431753-1431775 CTGCACAGTCCTCCCCAGCCAGG - Intronic
985904124 5:2819658-2819680 CTTGGTGTTCATCTCCAGCCTGG - Intergenic
986460924 5:7971507-7971529 CAGCATATTTATCTCCTTCCTGG + Intergenic
990731660 5:58815457-58815479 CTGGCTATTCATCCCCAGGCTGG - Intronic
991945563 5:71895380-71895402 CGGCATGAACATCTCCAGCCAGG + Intergenic
994095630 5:95844954-95844976 CTGGATTATCATCTCCAGCATGG + Intergenic
994131889 5:96238720-96238742 CTGCATAGTTTTCTACAGCCTGG + Intergenic
995336161 5:111002163-111002185 CTGCATATACAAGTCCAGCCTGG + Intergenic
998775502 5:145596054-145596076 CTGCACATTGCACTCCAGCCTGG + Intronic
999117454 5:149176246-149176268 CTGCTTCTTCATCACCTGCCAGG + Intronic
1002664323 5:180811142-180811164 CTGCAAATCCATCCCCAGTCCGG - Intronic
1004503293 6:16227517-16227539 CAGCATATTCATATCCAGCAAGG + Intergenic
1004537189 6:16514524-16514546 CTGAAATTTCATCTCCATCCTGG - Intronic
1004540088 6:16541498-16541520 CTGGTTTTTCATCACCAGCCAGG + Intronic
1006866040 6:37209801-37209823 CCCCATATACATCTTCAGCCTGG - Intergenic
1007926085 6:45650921-45650943 CTGCTTCTGCATCTTCAGCCAGG - Intronic
1008583364 6:52926312-52926334 CAGTATATTCATATCCAGCAAGG - Intergenic
1008786985 6:55180338-55180360 TTGCCTATGCATCTCCAGTCAGG - Intronic
1011378089 6:86712318-86712340 CTGGAAATTCATCTCCACCCTGG - Intergenic
1012502032 6:99898774-99898796 CTGCATTCTCATCTGAAGCCTGG + Intergenic
1012859507 6:104542746-104542768 CTTCATATTCATTACCACCCTGG - Intergenic
1013004554 6:106060061-106060083 CCTGATTTTCATCTCCAGCCTGG - Intergenic
1014440485 6:121468286-121468308 CTGCATAGACAACTCCAACCAGG - Intergenic
1015445838 6:133303908-133303930 CTCCACCTTCACCTCCAGCCAGG - Intronic
1018835500 6:167480375-167480397 CTGCATATTATACTCCACCCTGG + Intergenic
1019957278 7:4425298-4425320 CTGGATCTTCATCTCCACCCAGG - Intergenic
1023306359 7:38832850-38832872 CTACATTTTTATCTCCAGGCAGG + Intronic
1025708935 7:63890513-63890535 CTGGGGATTCATCTCCAGCATGG - Intergenic
1026054239 7:66970815-66970837 CTCCACATCCAGCTCCAGCCAGG - Intergenic
1026644809 7:72158368-72158390 ATGCAAACTCATCTCCTGCCTGG - Intronic
1028289270 7:89045076-89045098 CAGCTGATTCAGCTCCAGCCAGG + Intronic
1029475995 7:100784966-100784988 TGGCACATTGATCTCCAGCCAGG + Intronic
1032042227 7:128572860-128572882 CTGCACATTGCACTCCAGCCTGG - Intergenic
1032793303 7:135258273-135258295 CTGCATTTTCACCTCCAGCTTGG - Intronic
1037091346 8:14923098-14923120 CTGCAAAGTCATCTCCTGACAGG + Intronic
1039483928 8:37897196-37897218 ATGCCTATTCATCTCTGGCCAGG + Intronic
1039833284 8:41235183-41235205 CTGCATACTGCACTCCAGCCTGG + Intergenic
1040880319 8:52198056-52198078 CTGCACATTGCACTCCAGCCTGG - Intronic
1041008738 8:53520979-53521001 CAGCATATTTATATCCAGCAAGG + Intergenic
1042526698 8:69771920-69771942 CTCTTTATTCAGCTCCAGCCTGG + Intronic
1042526844 8:69772760-69772782 CTGCATAGTCACCTCCTTCCTGG + Intronic
1044240522 8:89882875-89882897 CTGTAAATTCTTCTCCAGCAGGG - Intergenic
1044958546 8:97506500-97506522 CTGCATCTTCATCTGCTGGCAGG - Intergenic
1048105645 8:131405718-131405740 CTGGTTATTAATCTCAAGCCTGG - Intergenic
1048507563 8:135034748-135034770 CTGCAGATGAATGTCCAGCCCGG - Intergenic
1048869693 8:138786954-138786976 CTGCCTATTCATCTTCCACCAGG + Intronic
1053583510 9:39432060-39432082 GTGCTAATTCAACTCCAGCCTGG - Intergenic
1054105090 9:60990803-60990825 GTGCTAATTCAACTCCAGCCTGG - Intergenic
1058147776 9:101430776-101430798 CTACAGATTCATCTGCAGCCAGG + Exonic
1058282022 9:103127702-103127724 ATGAGTATTCATCTCCAGTCTGG - Intergenic
1058378857 9:104356979-104357001 ATTCATATTCATTTCCAGCTGGG + Intergenic
1060396795 9:123321947-123321969 CTCCACCCTCATCTCCAGCCAGG + Intergenic
1060977016 9:127770833-127770855 CAGCACATTCCTCTCCAGCAGGG - Intronic
1061794576 9:133078406-133078428 CAGCGTATTCATATCCAGCAAGG + Intronic
1061987337 9:134137031-134137053 CTGCATCTTAAACACCAGCCGGG - Intronic
1062469239 9:136695127-136695149 CTAAACATTCATTTCCAGCCGGG + Intergenic
1185557357 X:1031854-1031876 CTTCATATTAATCGGCAGCCGGG + Intergenic
1185783051 X:2865807-2865829 CTTCATACTCTTCTCCATCCTGG - Intronic
1186824496 X:13325787-13325809 CTGCATATTCATCTGTTGCTCGG - Intergenic
1188878246 X:35459993-35460015 CTGCAGAGTCATCTCCACCAAGG + Intergenic
1190246055 X:48691120-48691142 CTTCATCTTCATCGCCAGCCTGG - Exonic
1190925757 X:54902284-54902306 CAGAATCTACATCTCCAGCCTGG + Intergenic
1194668371 X:96700467-96700489 CTGCATCTGCATCTGCATCCAGG - Intronic
1195511096 X:105716070-105716092 CTGTATTTTCATCTACAGCAGGG - Intronic
1196758459 X:119178340-119178362 CTGCCTCTCCATCCCCAGCCTGG + Intergenic
1197311045 X:124905793-124905815 CTGCATATTCACCTGCACTCTGG + Intronic
1198614391 X:138439756-138439778 CAGCCTATTCTACTCCAGCCTGG - Intergenic
1198993036 X:142538227-142538249 CTGCATATAGCTCTCCTGCCCGG + Intergenic
1199482385 X:148311802-148311824 ATGCATTTGCATCTCCAGCATGG + Intergenic
1199993273 X:153002137-153002159 CTGCATCCCCATCTCCTGCCTGG + Intergenic
1201500409 Y:14635939-14635961 CTGTATATTCATCTCAAGACTGG - Intronic
1201505601 Y:14696065-14696087 CTGCATCTTCATGTCCAGCAGGG + Intronic