ID: 1074768173

View in Genome Browser
Species Human (GRCh38)
Location 10:116715985-116716007
Sequence TCATCTGCGAGGGGGCCAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 75}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768173_1074768184 25 Left 1074768173 10:116715985-116716007 CCCACTGGCCCCCTCGCAGATGA 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1074768184 10:116716033-116716055 GAGCAGCTCCCACTCTGGGATGG No data
1074768173_1074768185 26 Left 1074768173 10:116715985-116716007 CCCACTGGCCCCCTCGCAGATGA 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768173_1074768183 21 Left 1074768173 10:116715985-116716007 CCCACTGGCCCCCTCGCAGATGA 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1074768183 10:116716029-116716051 AGCTGAGCAGCTCCCACTCTGGG No data
1074768173_1074768182 20 Left 1074768173 10:116715985-116716007 CCCACTGGCCCCCTCGCAGATGA 0: 1
1: 0
2: 1
3: 6
4: 75
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074768173 Original CRISPR TCATCTGCGAGGGGGCCAGT GGG (reversed) Intronic
900572315 1:3364689-3364711 TCAGCTGCGCGGGGGACAGGCGG + Intronic
905540937 1:38760049-38760071 GCATCTACTGGGGGGCCAGTTGG - Intergenic
905638716 1:39574173-39574195 TCATCTGTGTGGGGGGTAGTTGG + Intronic
907282913 1:53362615-53362637 TCAGCTGTGAGGGAGGCAGTGGG - Intergenic
912704809 1:111904145-111904167 CCATCTGGGAGGGGTGCAGTGGG - Intronic
914240481 1:145849598-145849620 TCCCCAGCGTGGGGGCCAGTGGG + Exonic
923024594 1:230194660-230194682 GCAGCTGCGAGGTGGCCAGGAGG + Intronic
1071905947 10:90173735-90173757 TCATCTGGGAGGGGGTGAGTGGG + Intergenic
1072944660 10:99798929-99798951 CCATCTGCGTGGGGGCCTGAGGG - Intronic
1074768173 10:116715985-116716007 TCATCTGCGAGGGGGCCAGTGGG - Intronic
1075914493 10:126155770-126155792 TCACCTGCGGGGGAGCCAGCAGG - Intronic
1076648048 10:131967208-131967230 TCATCTGTGAGGGGGACACGTGG + Exonic
1077047026 11:551220-551242 TCAGCCGCGGGGGGGCCGGTGGG - Exonic
1085326309 11:75609400-75609422 TCATCAGTGAGGGAGACAGTGGG - Intronic
1085670616 11:78461085-78461107 CTATCTGAGAGGGGGCTAGTGGG + Intronic
1089698351 11:120229271-120229293 TCATGTGAGATGGGGCCAGAGGG - Exonic
1093287798 12:17286894-17286916 AAAACTGCAAGGGGGCCAGTGGG + Intergenic
1101187170 12:102291665-102291687 TGATCTGGGAGGGACCCAGTGGG + Intergenic
1104982727 12:132581498-132581520 CCACCTGTCAGGGGGCCAGTGGG - Exonic
1109099035 13:58156082-58156104 TCTCCTGAGATGGGGCCAGTTGG - Intergenic
1117451791 14:55858277-55858299 TGTTCTGGGAGGGGCCCAGTGGG + Intergenic
1122788610 14:104175157-104175179 TCATCTACGTGGGGCCCGGTGGG + Exonic
1128479697 15:68026645-68026667 TGATGTGGGAGGGGCCCAGTGGG - Intergenic
1128687099 15:69695013-69695035 TCATCTGCGAGGAGGTGAGGAGG + Intergenic
1128922747 15:71627317-71627339 TCATCTGTGACAGGGCCAGTAGG + Intronic
1131700727 15:94933309-94933331 TTATCTGAGTGGGGGCCAGAAGG - Intergenic
1138588869 16:57988562-57988584 TGTTGTGGGAGGGGGCCAGTGGG - Intergenic
1143565230 17:7716990-7717012 ACATCTCCGAGGGTGCCAGGGGG - Intergenic
1144782316 17:17814296-17814318 CCATCTGTGAGAAGGCCAGTGGG - Exonic
1147978387 17:44260597-44260619 TCATCTGCAGGGGGTCCAGAAGG + Intronic
1157814397 18:50720492-50720514 TCATATGGGAGGCAGCCAGTGGG - Intronic
1159534974 18:69704243-69704265 ACATCTGCGAGGGGACAAGTAGG + Intronic
1162717355 19:12642452-12642474 TCACCTGCGACGGCACCAGTCGG + Intergenic
1163152089 19:15421710-15421732 GCATTTGGGTGGGGGCCAGTGGG - Exonic
1163443048 19:17331212-17331234 TCATCTGCCAGGGGACAAGTGGG + Exonic
1164643441 19:29842681-29842703 TGAACTGGGAGGGGGCCAGCTGG + Intergenic
1165090052 19:33381567-33381589 TCAGCTGCTAAGGAGCCAGTAGG - Exonic
1166949480 19:46416891-46416913 TCATCTGCGAGGTCACCACTTGG - Intergenic
927846712 2:26476078-26476100 TCACCTGGGAGGGGGCCGGAGGG - Intronic
931807182 2:65818574-65818596 TCATCTGGGAGTGAGCCAGGAGG - Intergenic
935019148 2:99213632-99213654 TGTTGTGCGAGGGGCCCAGTGGG + Intronic
936255837 2:110910119-110910141 TCAACTGCAAAGGGGCCAGAGGG - Intronic
938066235 2:128283418-128283440 TCCTCTGCCAGGGGGTCACTGGG - Intronic
939709749 2:145502267-145502289 TCTTCTGGGAGGGAGGCAGTTGG + Intergenic
947468707 2:230380287-230380309 TCATGTGGGAGGGACCCAGTGGG - Intronic
1169799218 20:9497988-9498010 TGTTCTGAGATGGGGCCAGTGGG - Intergenic
1170791515 20:19512855-19512877 TCATCAACGAGGGGTACAGTGGG - Intronic
1171445352 20:25198936-25198958 TCATCTGGGAAGGGGCCATTTGG - Intronic
1172009517 20:31838255-31838277 TCATCTTGGAGCAGGCCAGTAGG + Intergenic
1173404036 20:42749355-42749377 CCATCTCAGATGGGGCCAGTCGG + Intronic
1175372094 20:58499069-58499091 TCTTCTGCGGGAGGGACAGTTGG + Intronic
1181330003 22:22083315-22083337 TCATCTGCCAAGGGGCAAGGGGG + Intergenic
950844962 3:16006358-16006380 TGATGTGGGAGGGGCCCAGTAGG - Intergenic
953957217 3:47240692-47240714 TGAGATGGGAGGGGGCCAGTGGG - Intronic
953958714 3:47250844-47250866 TGGTCTGGGAGAGGGCCAGTGGG - Intronic
954373438 3:50182265-50182287 TCATCTGTGGGTAGGCCAGTGGG - Exonic
954660989 3:52226681-52226703 TCAACTGCAAGCAGGCCAGTGGG - Intergenic
965228118 3:166017907-166017929 TTATTTGGGAGGGGCCCAGTGGG + Intergenic
967842970 3:194021679-194021701 TCATCAGGGAAGGGGCCACTGGG - Intergenic
968509807 4:990706-990728 ACATCTGCATGGGGGGCAGTGGG - Intronic
968572514 4:1349478-1349500 TCCTCTGCGTGTGGGGCAGTTGG + Intronic
969063888 4:4461832-4461854 CTTTCTGCGAGGGGGCCAGAGGG - Intronic
973150707 4:46884158-46884180 TTATGTGTGAGGGGGCCAGTTGG + Intronic
977258811 4:94772210-94772232 TCATCTGCCAGCCAGCCAGTGGG + Intronic
981994339 4:150959324-150959346 TCATGTGGGAGGGACCCAGTGGG - Intronic
985569053 5:633957-633979 TCATCTGCCAGGAGGCCAGTGGG + Intronic
997951753 5:138247910-138247932 ACATCTGAGAGGGGACCTGTAGG - Intergenic
998527852 5:142858972-142858994 TTATCTGCAAGTTGGCCAGTGGG + Intronic
999147086 5:149403599-149403621 TCAGCTCAGAGGTGGCCAGTTGG - Intronic
1001683984 5:173578740-173578762 TCACTTGCAAGGAGGCCAGTGGG + Intergenic
1002303174 5:178268991-178269013 TCTGCTGCGAGGATGCCAGTGGG - Intronic
1002595036 5:180316592-180316614 TTATCTTCGAGGTGGCCTGTGGG - Intronic
1015044417 6:128760805-128760827 TCTGCTGGGAGGGGCCCAGTGGG - Intergenic
1029605018 7:101593441-101593463 ACTTCTGCCAGGGGTCCAGTTGG + Intergenic
1034434513 7:151056978-151057000 GCATATGTGAGGGGGCCGGTGGG + Intronic
1037095997 8:14988868-14988890 TCATTTGTTAGAGGGCCAGTGGG - Intronic
1039470357 8:37809621-37809643 GCATCTGCGAGTGGGTCAGAGGG + Intronic
1042149897 8:65770503-65770525 TGTTCTGGGAGGGGCCCAGTGGG - Intronic
1057230375 9:93317955-93317977 TCAGCCGCGAGGGGGACAGCGGG + Exonic
1188435093 X:30150187-30150209 TCATCTGCAATGTGGCAAGTGGG - Intergenic
1188509196 X:30915764-30915786 TTATCTGTTAGGGGGCCATTAGG + Intronic
1189718516 X:43890346-43890368 TTATCTGCGAGTTAGCCAGTGGG + Intergenic
1198296513 X:135292708-135292730 GCATCTGGGTGGGGGCCACTGGG - Intronic