ID: 1074768174

View in Genome Browser
Species Human (GRCh38)
Location 10:116715986-116716008
Sequence GTCATCTGCGAGGGGGCCAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 135}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768174_1074768185 25 Left 1074768174 10:116715986-116716008 CCACTGGCCCCCTCGCAGATGAC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768174_1074768183 20 Left 1074768174 10:116715986-116716008 CCACTGGCCCCCTCGCAGATGAC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1074768183 10:116716029-116716051 AGCTGAGCAGCTCCCACTCTGGG No data
1074768174_1074768184 24 Left 1074768174 10:116715986-116716008 CCACTGGCCCCCTCGCAGATGAC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1074768184 10:116716033-116716055 GAGCAGCTCCCACTCTGGGATGG No data
1074768174_1074768182 19 Left 1074768174 10:116715986-116716008 CCACTGGCCCCCTCGCAGATGAC 0: 1
1: 0
2: 1
3: 11
4: 135
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074768174 Original CRISPR GTCATCTGCGAGGGGGCCAG TGG (reversed) Intronic
900188914 1:1345193-1345215 GACATCTGTGAGGGGGCAGGGGG - Intronic
900504260 1:3021470-3021492 GGCCTCTTCCAGGGGGCCAGGGG - Exonic
900952824 1:5867548-5867570 GTCATCTCAGAGGTGGCAAGAGG + Intronic
901379097 1:8861057-8861079 GTCATCTCCGGGGTGGCCACAGG - Exonic
902999367 1:20254013-20254035 GGCATCTGGGATGGGGCAAGAGG - Intergenic
903750016 1:25616136-25616158 GTGGTCTGCGAGGGGGCCAGTGG + Intergenic
903768690 1:25750556-25750578 TTCATCTGTGAAGGTGCCAGGGG + Intronic
904039309 1:27575235-27575257 CTCATCTGGGAGGGGGGCGGAGG - Intronic
905647743 1:39636063-39636085 GTCATCTGCAAGGGTTCCACGGG - Intronic
906153315 1:43600251-43600273 CTCCTCTCTGAGGGGGCCAGTGG + Intronic
907282914 1:53362616-53362638 GTCAGCTGTGAGGGAGGCAGTGG - Intergenic
907973613 1:59409321-59409343 TTCCTCTGCGAGAGGCCCAGGGG + Intronic
910754578 1:90673901-90673923 GTCATGTGTGAGGTGGCCACAGG - Intergenic
912709571 1:111940765-111940787 GTCATCGGTGAGGGGTGCAGTGG - Intronic
915497798 1:156293791-156293813 GAGATCTGCAAGGGGGCTAGGGG - Intronic
922485908 1:225972803-225972825 GTCAGCGGCGAGGAGGCCACAGG + Intergenic
922703559 1:227776503-227776525 GTCAGCTCCGAGGCAGCCAGTGG - Intronic
923086929 1:230709195-230709217 GGCATCTCAGAGGAGGCCAGAGG - Intronic
923723242 1:236484828-236484850 GTCATCTCCGGGGTGGCCACAGG + Intronic
1069935024 10:71909419-71909441 GTCCTCTGGGTGGGGGCCACAGG + Intergenic
1071905946 10:90173734-90173756 CTCATCTGGGAGGGGGTGAGTGG + Intergenic
1072944662 10:99798930-99798952 CCCATCTGCGTGGGGGCCTGAGG - Intronic
1074768174 10:116715986-116716008 GTCATCTGCGAGGGGGCCAGTGG - Intronic
1077477223 11:2796239-2796261 GTCACCTGGCAGGGGGCCAGGGG - Intronic
1077610984 11:3642866-3642888 GTCATGGGAGAAGGGGCCAGCGG + Intergenic
1078893582 11:15578837-15578859 GTCAAATGCTAGGGAGCCAGAGG - Intergenic
1079701434 11:23553382-23553404 GTATTCTGGGAGGGGCCCAGGGG - Intergenic
1083793017 11:64998075-64998097 GGCATCTGTTTGGGGGCCAGAGG + Intergenic
1083935429 11:65867517-65867539 GTTAGGTGGGAGGGGGCCAGGGG - Intronic
1083962110 11:66020412-66020434 GCCCTCAGCGAGGAGGCCAGAGG + Intronic
1084516073 11:69638553-69638575 GTCACCGGGGCGGGGGCCAGGGG + Intergenic
1084569744 11:69952077-69952099 GTCAGCTGGGAGGTGGGCAGAGG + Intergenic
1085326310 11:75609401-75609423 GTCATCAGTGAGGGAGACAGTGG - Intronic
1085670615 11:78461084-78461106 GCTATCTGAGAGGGGGCTAGTGG + Intronic
1088357853 11:108961819-108961841 GTTATTTGGGAGGTGGCCAGAGG - Intergenic
1089698352 11:120229272-120229294 GTCATGTGAGATGGGGCCAGAGG - Exonic
1091357817 11:134951328-134951350 GTCCTGTGTGAGGGAGCCAGGGG + Intergenic
1093287797 12:17286893-17286915 GAAAACTGCAAGGGGGCCAGTGG + Intergenic
1096026948 12:48374656-48374678 GGCATCTGAGTGGGTGCCAGGGG - Intergenic
1103338894 12:120210737-120210759 GGCTTCTGCCAGGAGGCCAGTGG + Exonic
1115840188 14:37461515-37461537 GAGATTTGGGAGGGGGCCAGGGG - Intronic
1117451790 14:55858276-55858298 GTGTTCTGGGAGGGGCCCAGTGG + Intergenic
1120929822 14:89837061-89837083 GTCAGCTGCTAAGAGGCCAGAGG + Intronic
1121465329 14:94111927-94111949 TCCATCTGGGAGGGGGCCCGGGG + Intronic
1122036163 14:98950708-98950730 CTCACCTGTGAGGGGGGCAGGGG - Intergenic
1122788609 14:104175156-104175178 GTCATCTACGTGGGGCCCGGTGG + Exonic
1128479698 15:68026646-68026668 GTGATGTGGGAGGGGCCCAGTGG - Intergenic
1130409214 15:83630815-83630837 GAGATTTGGGAGGGGGCCAGGGG - Intergenic
1131070146 15:89460950-89460972 GTCATCCGCTGGGGGGCCAAGGG - Intergenic
1131378915 15:91947917-91947939 GTCACCTGCACGGGGGCCAAAGG - Intronic
1131597037 15:93808574-93808596 GTCAACTGTAAGGGAGCCAGAGG - Intergenic
1132704518 16:1237332-1237354 GTCCCCTGGGAGGGGGCCTGGGG + Intergenic
1132773129 16:1575812-1575834 GGCTTCTGGGAGAGGGCCAGTGG - Intronic
1136136653 16:28260381-28260403 GTGATCTGCAAGGGAGACAGGGG + Intergenic
1138880934 16:61014452-61014474 GTCCTCTGGGAGGGCTCCAGAGG + Intergenic
1140455762 16:75104766-75104788 ATCATCTGCAAGGGGGACAGGGG - Exonic
1143360986 17:6371116-6371138 GTTACCTACGAGGGGGACAGAGG + Intergenic
1143565231 17:7716991-7717013 TACATCTCCGAGGGTGCCAGGGG - Intergenic
1145304538 17:21666140-21666162 GTCATCTTCGGGGTGGCCAAGGG - Intergenic
1147615007 17:41822444-41822466 GCCCACTGCGAGGGGGACAGTGG + Exonic
1148746208 17:49919872-49919894 GACCTCCGCGATGGGGCCAGGGG - Intergenic
1151570171 17:74921996-74922018 GTCATGGGAGAGAGGGCCAGGGG - Intronic
1152755020 17:82083632-82083654 GTCAACGCCTAGGGGGCCAGAGG + Exonic
1154497089 18:14969825-14969847 GTCCTGTGTGAGGGAGCCAGGGG - Intergenic
1157814398 18:50720493-50720515 GTCATATGGGAGGCAGCCAGTGG - Intronic
1158314788 18:56199884-56199906 GACAGCTGCAAGGGGGTCAGTGG + Intergenic
1160530241 18:79558342-79558364 GTCCTCTGCCAGGGGCCCACAGG + Intergenic
1160797635 19:953221-953243 GACAGCTCCGAGGGGGTCAGTGG - Intronic
1161442877 19:4302401-4302423 GTCAACTGGGAGGGGGAGAGGGG - Exonic
1163443047 19:17331211-17331233 GTCATCTGCCAGGGGACAAGTGG + Exonic
925971328 2:9108482-9108504 GCCATCTGTGAGGGAGGCAGCGG - Intergenic
927846713 2:26476079-26476101 CTCACCTGGGAGGGGGCCGGAGG - Intronic
928406481 2:31018948-31018970 GTCATTTGTGAGGGGGCCTGGGG - Intronic
929570818 2:43021914-43021936 CCCAGCTGCGAGGGGGCCCGAGG + Intergenic
931151530 2:59579728-59579750 GCAATCTGAGAGGGGACCAGTGG - Intergenic
931268996 2:60685535-60685557 CCCATCTGAGAGGGGGACAGGGG - Intergenic
931286847 2:60839597-60839619 GTCATCTGGGGTGGGGCCTGAGG + Intergenic
932226456 2:70044857-70044879 GTCAGGTGTGATGGGGCCAGAGG - Intergenic
933658378 2:84906984-84907006 GTCAGCTAGGAGGAGGCCAGAGG - Intronic
936255838 2:110910120-110910142 GTCAACTGCAAAGGGGCCAGAGG - Intronic
938066236 2:128283419-128283441 GTCCTCTGCCAGGGGGTCACTGG - Intronic
947868905 2:233421564-233421586 GGCATCAGGAAGGGGGCCAGGGG - Intronic
948655643 2:239475390-239475412 GACATCTGCCAAGGGGACAGAGG + Intergenic
948663005 2:239518261-239518283 GTCAGCTAGGAGGTGGCCAGTGG + Intergenic
949036231 2:241816824-241816846 GTGATCTACGAGGGCCCCAGCGG + Exonic
1169799219 20:9497989-9498011 GTGTTCTGAGATGGGGCCAGTGG - Intergenic
1171471966 20:25379361-25379383 GCCATCTGCTAGGAGGGCAGAGG - Intronic
1173523519 20:43715941-43715963 GACATCTGGGAGGAGGCAAGAGG - Exonic
1173658946 20:44719932-44719954 GGCATCGGGGAGGTGGCCAGGGG - Exonic
1175521452 20:59604925-59604947 GTCACCGGCGAGGGGGCTGGAGG - Exonic
1176173280 20:63706110-63706132 GTTCCCTGCGATGGGGCCAGTGG - Intronic
1181330002 22:22083314-22083336 ATCATCTGCCAAGGGGCAAGGGG + Intergenic
1185109759 22:48894372-48894394 TTCAGATGCGAGGCGGCCAGAGG - Intergenic
952710626 3:36428726-36428748 GTGATCAGCAAGGAGGCCAGAGG + Intronic
953386584 3:42509740-42509762 GTCCTCTGCCATGGGGCTAGCGG + Intronic
954660990 3:52226682-52226704 GTCAACTGCAAGCAGGCCAGTGG - Intergenic
954810463 3:53244082-53244104 GTCAGCTGCGAGGTGACCAAGGG + Intronic
954875316 3:53799433-53799455 GGCAGCTGTGAGGGCGCCAGGGG + Intronic
957797556 3:85031141-85031163 CACATCTGTGAGTGGGCCAGTGG - Intronic
961792190 3:129384250-129384272 GTCACCTGCAAGGCAGCCAGAGG + Intergenic
964909318 3:161758811-161758833 GTCATCGTCCAGGAGGCCAGAGG - Intergenic
965228117 3:166017906-166017928 GTTATTTGGGAGGGGCCCAGTGG + Intergenic
967842971 3:194021680-194021702 GTCATCAGGGAAGGGGCCACTGG - Intergenic
968231520 3:197007534-197007556 GTCGTCTGGGATGGGGTCAGGGG - Intronic
969063889 4:4461833-4461855 GCTTTCTGCGAGGGGGCCAGAGG - Intronic
970829206 4:20316043-20316065 GGAATCTGGGAGGAGGCCAGAGG - Intronic
975722006 4:77257048-77257070 GGCATCTACAAGGTGGCCAGGGG - Intronic
977629593 4:99227289-99227311 GTCATGTGCGGGGAGGCTAGGGG - Intergenic
977973171 4:103233853-103233875 GAGATTTGGGAGGGGGCCAGGGG + Intergenic
983885474 4:172975723-172975745 CTCATCGGCGAGGGGGCTAAGGG + Intronic
985569052 5:633956-633978 CTCATCTGCCAGGAGGCCAGTGG + Intronic
990241961 5:53824932-53824954 GGCATCTGAGTTGGGGCCAGGGG + Intergenic
993946023 5:94117419-94117441 GAGATTTGGGAGGGGGCCAGAGG + Intergenic
994014156 5:94945846-94945868 GTCTTCTGCAAGGGGGGAAGAGG + Intronic
997368849 5:133343227-133343249 GTCCTCTGTGAGGAGGACAGAGG + Intronic
998461621 5:142314246-142314268 GTCATCTGCAAAGCAGCCAGCGG - Exonic
1001683983 5:173578739-173578761 GTCACTTGCAAGGAGGCCAGTGG + Intergenic
1001769588 5:174283232-174283254 TTCATCTGGGAGGGGGACAGTGG + Intergenic
1007659863 6:43477507-43477529 GTCATCTGAGGCGGGGCCATGGG - Exonic
1011265315 6:85512036-85512058 GTCCTGTGCAAGGGGGTCAGGGG - Intronic
1011734538 6:90297389-90297411 GTCAGCTTTGTGGGGGCCAGTGG - Intergenic
1013269090 6:108529128-108529150 GTCGACTGCCAAGGGGCCAGTGG - Intergenic
1015044418 6:128760806-128760828 GTCTGCTGGGAGGGGCCCAGTGG - Intergenic
1018217912 6:161548867-161548889 GTCACCTGCGAAGGGGGCAATGG - Exonic
1018285130 6:162229589-162229611 GTGATCTGGGAGAGGGGCAGGGG - Intronic
1019666280 7:2253699-2253721 GTCCACTGCGAGCCGGCCAGAGG - Exonic
1022615057 7:31920714-31920736 ATCAACTTCGAGGGAGCCAGGGG - Intronic
1023283720 7:38596732-38596754 GTCATGTGGGAGTGGGCAAGAGG - Intronic
1025282548 7:57638754-57638776 GTCATCTTGGAGGTGGCCAAGGG - Intergenic
1029041880 7:97584536-97584558 GTCATCTGGGCTGGGCCCAGTGG - Intergenic
1029668002 7:102008250-102008272 GACATGGGAGAGGGGGCCAGCGG - Intronic
1032390083 7:131550154-131550176 GTCCTCAGCCAGTGGGCCAGTGG + Intronic
1032894993 7:136240683-136240705 GCCATCCAGGAGGGGGCCAGAGG + Intergenic
1039470356 8:37809620-37809642 TGCATCTGCGAGTGGGTCAGAGG + Intronic
1040564145 8:48551058-48551080 TCCATCTGCCAGGAGGCCAGAGG - Intergenic
1042149898 8:65770504-65770526 GTGTTCTGGGAGGGGCCCAGTGG - Intronic
1043687409 8:83105069-83105091 GTCATCTGCAATGGGACCAAGGG + Intergenic
1048130600 8:131693170-131693192 GAGATTTGCCAGGGGGCCAGGGG - Intergenic
1053072418 9:35109061-35109083 GTCAGCTGAGAGGCGGCCAGGGG + Exonic
1054812563 9:69446649-69446671 CTTATCTGCGTGGGGACCAGAGG - Intronic
1057230374 9:93317954-93317976 CTCAGCCGCGAGGGGGACAGCGG + Exonic
1057502535 9:95607139-95607161 GTCATCAGCTGGGGGGCCAGAGG + Intergenic
1061076320 9:128343574-128343596 GACATCTGCAAGGGGTCCTGAGG + Intronic
1061793770 9:133071703-133071725 GTCATCTGTGGGGGGCACAGGGG - Exonic
1062535031 9:137017688-137017710 ATCACCTGCGGGTGGGCCAGGGG + Exonic
1186871804 X:13781188-13781210 GACCTCTGGGAGGGGGACAGTGG - Intronic
1187508708 X:19898524-19898546 GTCAGCTGAGACGGGGGCAGGGG - Intergenic
1188435094 X:30150188-30150210 GTCATCTGCAATGTGGCAAGTGG - Intergenic