ID: 1074768175

View in Genome Browser
Species Human (GRCh38)
Location 10:116715993-116716015
Sequence CTGTTTTGTCATCTGCGAGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 446
Summary {0: 1, 1: 0, 2: 4, 3: 49, 4: 392}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768175_1074768184 17 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG 0: 1
1: 0
2: 4
3: 49
4: 392
Right 1074768184 10:116716033-116716055 GAGCAGCTCCCACTCTGGGATGG No data
1074768175_1074768182 12 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG 0: 1
1: 0
2: 4
3: 49
4: 392
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data
1074768175_1074768183 13 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG 0: 1
1: 0
2: 4
3: 49
4: 392
Right 1074768183 10:116716029-116716051 AGCTGAGCAGCTCCCACTCTGGG No data
1074768175_1074768185 18 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG 0: 1
1: 0
2: 4
3: 49
4: 392
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074768175 Original CRISPR CTGTTTTGTCATCTGCGAGG GGG (reversed) Intronic
900876169 1:5343980-5344002 CTGTTTTCTCATCTGTGAAATGG + Intergenic
902276624 1:15344713-15344735 CTGTTTCCTCCTCTGCAAGGTGG + Intronic
902638115 1:17748258-17748280 CAGTTTTGTCATCTGCAAAAGGG + Intergenic
902699495 1:18161919-18161941 CTGTTTTCTCATCTGCAAAAGGG + Intronic
902704078 1:18192369-18192391 CAGTTTTCTCATCTGCAAGATGG + Intronic
903168762 1:21539246-21539268 CTGTTTTGTCATCTGTAAAATGG + Intronic
903190765 1:21654396-21654418 CAGTTTTTTCATCTGCAAGATGG + Intronic
903647795 1:24905266-24905288 CAGTTTTCTCATCTGTGAAGTGG - Intronic
903650294 1:24917871-24917893 CAGTTTTGTCATCTGAGAACTGG - Intronic
903977204 1:27158432-27158454 CTCTTTTGTCATTTCCCAGGTGG - Intronic
904201985 1:28825874-28825896 CTGTTTTCTCATCTGTGAAATGG + Intronic
904299959 1:29547887-29547909 CAGTTTCCTCATCTGTGAGGTGG - Intergenic
904309611 1:29620291-29620313 CTGTTTTCTCATCTGTAAAGTGG - Intergenic
904359245 1:29961429-29961451 CTGTTCTGACATCTTGGAGGAGG - Intergenic
904716574 1:32472325-32472347 CTGTTTTGTCATCTGTAAAACGG + Intronic
905242775 1:36591636-36591658 CAGTTTTGTCATCTGTGAAATGG + Intergenic
906709265 1:47916986-47917008 CTGTTTTCTCATCTGCAAGACGG - Intronic
907511573 1:54965249-54965271 CTGTTTACTCATCTGTGAAGTGG + Intergenic
907735803 1:57110819-57110841 CAGTTTTGTCATCTGCGAGTGGG - Intronic
907738296 1:57138136-57138158 CTGTTTAGACACCTGCTAGGAGG + Intronic
908712248 1:67029431-67029453 CTGATTTTTCATCAGAGAGGAGG - Intronic
908768626 1:67575710-67575732 CAGTTCTGTCATCTGTGAAGTGG + Intergenic
909504544 1:76373297-76373319 CTGTTTTCTCATCTGTAAGATGG + Intronic
910042174 1:82865826-82865848 CAGTTTTGTCATCTGCAGTGTGG + Intergenic
910415346 1:86991710-86991732 CTGTTTTCTCATCTGCAAAATGG + Intronic
911450645 1:98056095-98056117 CAGTTTTCTCATCTGCGAAATGG - Intergenic
912381100 1:109248745-109248767 CAGTTTTGTGACCAGCGAGGAGG - Intergenic
912587126 1:110777364-110777386 CTGTGTTGTCATCTGCAAGCAGG + Intergenic
912629775 1:111236561-111236583 CTGTTTCATCATCTGTGAAGTGG - Intronic
912792796 1:112669330-112669352 CTGTTTTCTCATCTGCAAAATGG + Intronic
913562045 1:120031458-120031480 CTGTTTTCTCACCTGAGAGTGGG - Intronic
913636079 1:120762136-120762158 CTGTTTTCTCACCTGAGAGTGGG + Intergenic
913965413 1:143373165-143373187 CTGTTTTGTCATCAGTGGGGTGG + Intergenic
914059787 1:144198767-144198789 CTGTTTTGTCATCAGTGGGGTGG + Intergenic
914119363 1:144767604-144767626 CTGTTTTGTCATCAGTGGGGTGG - Intergenic
914834157 1:151193482-151193504 CAGTTTTCTCATCTGCAAAGTGG + Intronic
917626879 1:176855056-176855078 TTGTTTTGTAATCTAGGAGGAGG - Intergenic
918439230 1:184549203-184549225 CAGTTTTGTCATCTGCAAAATGG + Intronic
920350453 1:205334804-205334826 CAGTTTTCTCATCTGCAAGATGG + Intergenic
921428903 1:215040313-215040335 CTGTTTTGTCATCTGTAAAGTGG - Intronic
922356953 1:224785556-224785578 CTGTTTTCTCATCTGTGAAATGG + Intergenic
924592300 1:245415031-245415053 CTGTTTTCTCATCTGTGAAGTGG + Intronic
1064456041 10:15488336-15488358 CAGTTTTGTCATCTGTAAGGTGG + Intergenic
1065094466 10:22267026-22267048 CTGTTCTGCCATCAGCAAGGTGG + Intergenic
1065280735 10:24135113-24135135 CTGTTTCTTCATCTGTAAGGTGG + Intronic
1066994363 10:42550664-42550686 ATGTTTTGCCAGCTGGGAGGTGG - Intergenic
1067940299 10:50649593-50649615 CTGTTTTCTCATCTGCTAAATGG + Intergenic
1068005074 10:51383497-51383519 CTGTTTTCTCAACTGCAAAGTGG - Intronic
1068087230 10:52389425-52389447 CCGTTCTGTCATCAACGAGGTGG - Intergenic
1068806848 10:61205705-61205727 CAGTTTTGTCATCTACAAAGTGG - Intergenic
1069444730 10:68462732-68462754 CTGTTTCCTCATCTGTAAGGAGG + Intronic
1069809588 10:71148598-71148620 CTGTTCTGTCTTCTCCCAGGTGG - Intergenic
1069876637 10:71567191-71567213 CAGTTTTCTCATCTGCAAAGTGG - Intronic
1070775033 10:79104468-79104490 CAGTTTTGTCATCTGCAAAATGG + Intronic
1070783997 10:79152747-79152769 CTGTTTCCTCATCTGTGAGATGG + Intronic
1070821535 10:79358360-79358382 TTGTTTTGTCATCTAGGAGGAGG + Intergenic
1071478042 10:86041783-86041805 CAGCTTTGTCATCTGAAAGGAGG + Intronic
1071780806 10:88842296-88842318 CTGTTTTCTCATCTGTAAAGAGG - Intronic
1071936948 10:90542552-90542574 CAGTTTTGTCATCTGCCAAGTGG - Intergenic
1072104369 10:92259910-92259932 ATGTTTTGTCATCTGCAACTAGG - Intronic
1072614244 10:97038848-97038870 CAGTTTTGTCATCTGTGAAATGG - Intronic
1073470991 10:103721977-103721999 CTGTTTTGTAATCTGTAATGTGG + Intronic
1074150041 10:110750977-110750999 GAGTTTTCTCATCTGCGAAGTGG + Intronic
1074768175 10:116715993-116716015 CTGTTTTGTCATCTGCGAGGGGG - Intronic
1074859245 10:117497836-117497858 CTCTTGTGTCATCTGTGAGTTGG - Intergenic
1078026996 11:7705584-7705606 CAGTTTTCTCATCTGCAATGTGG - Intronic
1078856503 11:15209723-15209745 CTATTTTCTCATCTGCAATGAGG - Intronic
1080406957 11:31987851-31987873 CTGTTTTGTCTTCTGTAAGATGG + Intronic
1081444329 11:43115782-43115804 CTGTTTTCTCATCTGTAAGAAGG + Intergenic
1081597530 11:44469353-44469375 CAGTTTTCTCATCTGTGAAGTGG - Intergenic
1082765519 11:57164473-57164495 CTGTTTTCTCATCTGTGAAATGG + Intergenic
1083163266 11:60868517-60868539 CTGTTTCCTCATCTGCAAGGTGG + Intronic
1083328886 11:61887903-61887925 CTGTTTTCTCATCTGTCAAGTGG + Intronic
1083621405 11:64051177-64051199 CAGTTTTGTCATCTGTGACATGG + Intronic
1083919826 11:65776368-65776390 GTGTTTTGTCATCTGGTAGCAGG - Exonic
1085294012 11:75420583-75420605 CTGTTTCCTCATTTGTGAGGGGG + Intronic
1085459661 11:76685982-76686004 CTGTTTTGTCATCTCTGAAAGGG - Intergenic
1085634049 11:78144284-78144306 CTGTTGTGTCAGCTGCTATGTGG - Intergenic
1085841502 11:80016585-80016607 CAGTTTTCTCATCTGCAAAGTGG + Intergenic
1086269743 11:85047592-85047614 CTGTTTTCTCATCTGCAAGATGG + Intronic
1087122805 11:94592258-94592280 GTGTTTTCTCATCTGCAAAGGGG + Intronic
1087716880 11:101618621-101618643 CTGTTTTCTCATCTGTAAGATGG - Intronic
1088015496 11:105053914-105053936 CTGTTTTCTCATCTGCAAAATGG - Intronic
1088322448 11:108568048-108568070 GTGTTTTGTCTTCAGCGAGTCGG - Intronic
1088903913 11:114139746-114139768 CTGTTTGGTCACTTGCCAGGAGG - Intronic
1089348681 11:117808919-117808941 CAGTTTTCTCATCTGTGAGATGG - Intronic
1090267459 11:125362286-125362308 CTGTTTTCTCATCTGTGAAATGG + Intronic
1090488121 11:127133099-127133121 CTATTTTGTCATCTTCAAAGTGG - Intergenic
1090804979 11:130197329-130197351 CAGCTTTGTCATCTGCAAAGTGG + Intronic
1091159747 11:133409172-133409194 CAGTTTCCTCATCTGCGAAGTGG - Intronic
1091538101 12:1432561-1432583 CTGTTTTGTCATCTGTAAACTGG - Intronic
1091574350 12:1719510-1719532 CTGTTTTGTCATCTGCCAAATGG + Intronic
1091736084 12:2923194-2923216 CAGTTTTCTCATCTGCAAAGGGG - Intronic
1092878701 12:12871009-12871031 CTGTTTTCTCATCTGCGAAATGG + Intergenic
1096016873 12:48284402-48284424 CTGTTTTCTCATCTGCAAAATGG + Intergenic
1096470561 12:51872778-51872800 CTGTTTTCTCATCTGTAAGATGG + Intergenic
1096525894 12:52210156-52210178 CTGTTTTGTCATCTGTAAAGTGG + Intergenic
1096733410 12:53633097-53633119 CTGTTCTGTCATCAACAAGGTGG - Intronic
1099076883 12:78120745-78120767 CTGTTTTCTCATCTGCAAAATGG + Intronic
1101540281 12:105658892-105658914 CTGTTTTCTCATCTGTGAAGTGG - Intergenic
1101819673 12:108174078-108174100 CGGTTTTGTCATCTGTCAAGTGG - Intronic
1101826060 12:108220990-108221012 CAGTTTTCTCATCTGTGAGATGG + Intronic
1101875196 12:108592818-108592840 CTGTTTTTTCATCTGCAAAATGG - Intronic
1102013275 12:109631974-109631996 CTGTTTTCTCATCTGTGAAATGG + Intergenic
1102497398 12:113329208-113329230 CAGTTTTCTCATCTGTGAAGTGG - Intronic
1102550689 12:113689714-113689736 CTGTTTTCTCATCTGTGAAATGG - Intergenic
1102768804 12:115455402-115455424 CTGTTTTTCCATCTGTGAGATGG + Intergenic
1102866279 12:116377454-116377476 CTGTTTTGCCATATGGGAGGAGG - Intergenic
1102956246 12:117060949-117060971 CTGTTTTCTCGTCTGTGAGGAGG + Intronic
1103349775 12:120276093-120276115 CAGTTTTCTCATCTGTGAGATGG + Intergenic
1103914405 12:124369108-124369130 CAGTTTTCTCATCTGTAAGGTGG - Intronic
1104049174 12:125185046-125185068 CAGTTTTCTCATCTGAGAGATGG - Intergenic
1104198568 12:126565523-126565545 CTGTTTCCTCATCTGCAAAGAGG + Intergenic
1104405592 12:128513856-128513878 CTTTTTGGTCAGCTGCAAGGAGG - Intronic
1105683699 13:22754892-22754914 CAGTTTTTTCATCTGCAAGAAGG + Intergenic
1106032934 13:26018809-26018831 CAGTTTTCTCATCTGTGAAGTGG + Intronic
1106137874 13:26987828-26987850 CTGTTTTTTCATCTGCAAAATGG + Intergenic
1106285509 13:28315115-28315137 CTGTTTTCTCATCTGTGAAATGG + Intronic
1109167671 13:59056071-59056093 CAGTTTTTTCATCTGTGAAGTGG - Intergenic
1110281259 13:73696718-73696740 CAGTTTTCTCATCTGTGAAGTGG - Intronic
1110815450 13:79855761-79855783 CTGTTTTGTAAACTGCCAGAAGG + Intergenic
1112175336 13:97017691-97017713 CAGTTTTCTCATCTGTAAGGTGG - Intergenic
1112717149 13:102200058-102200080 CAGTGTTGTCATCTGTGATGGGG + Intronic
1112816031 13:103274672-103274694 CAATTTTGTCATCTGCTAAGGGG + Intergenic
1112974340 13:105299079-105299101 TTGTTTTCTCATCTGCAAAGTGG - Intergenic
1114487674 14:23072916-23072938 CTGTCTTGTAATCTGCAAAGTGG + Intronic
1115285065 14:31706642-31706664 CTCTTTTCTCAGCAGCGAGGAGG + Intronic
1116054795 14:39850002-39850024 CTGTTTCCTCATCTGCAAGCTGG - Intergenic
1121183960 14:91950447-91950469 CAGTTTTCTCATCTGCAAGATGG + Intergenic
1121261125 14:92566862-92566884 CTATTTTCTCATCTGCATGGAGG + Intronic
1121306330 14:92910031-92910053 CAGTTTTCTCATCTGCCAGTTGG - Intergenic
1121764661 14:96475668-96475690 CTGTTTTGACATCTTCAGGGGGG - Intronic
1122045210 14:99018020-99018042 CTGTTTCCTCATCTGGGAGGTGG + Intergenic
1122095977 14:99372771-99372793 CTGTTTTCTCATCTGTAAAGTGG + Intergenic
1122244895 14:100395451-100395473 CAGTTTTGTCATCTGTAAAGGGG - Intronic
1123041907 14:105493717-105493739 CTCTTTCCTCATCTGGGAGGTGG + Intronic
1126109223 15:45166054-45166076 CTGTTTTCTCATCTGCAAAATGG + Intergenic
1126315946 15:47369970-47369992 CTGTTTTTTCATCTGCAAAATGG - Intronic
1126671743 15:51121757-51121779 CTGTTTTTTCACTTGGGAGGAGG - Intergenic
1127279488 15:57476850-57476872 CTGTTTTGTCAGCAGTGAGTAGG + Intronic
1127961103 15:63891552-63891574 CTGTTTTCTCATCTGCAAAATGG + Intergenic
1128088647 15:64904157-64904179 TTGTTTTCTCATCTGGAAGGTGG - Intronic
1128213754 15:65920160-65920182 CTGTTTCCTCATCTTTGAGGTGG + Intronic
1128545841 15:68567027-68567049 CAGTTTTCTCATCTGTGAAGTGG + Intergenic
1128634709 15:69295775-69295797 CCGTTTTCTCATCTGCCAAGTGG + Intergenic
1128765137 15:70246751-70246773 CAGTTTTCTCATCTGCAAAGTGG + Intergenic
1130308570 15:82732663-82732685 CTGTTTTGTCATCAGCAAAAAGG - Intergenic
1130660024 15:85824048-85824070 CTGTTTCTTCATCTGCAAAGTGG - Intergenic
1130791015 15:87156470-87156492 CAGATGTGTCATCTTCGAGGAGG + Intergenic
1131473545 15:92716765-92716787 CTGTTTTGTTATCTGTAAAGTGG - Intronic
1133304703 16:4801811-4801833 CTGTTTTGTATTCCCCGAGGCGG - Intronic
1133443336 16:5838679-5838701 CTGTTTTCTTATCTGCAAAGTGG + Intergenic
1133747116 16:8695686-8695708 CCGTTTTCTCATCTGCTAAGTGG + Intronic
1135166360 16:20142664-20142686 CTGTTTTCTCATCTGCAAAATGG + Intergenic
1135891695 16:26363224-26363246 CAGTTTCTTCATCTGCAAGGTGG + Intergenic
1136500639 16:30668319-30668341 CTGTTTTATCATCTTCAAGTGGG + Intronic
1137333671 16:47526936-47526958 CTGTTTTGTCTTCTGCCTTGAGG - Intronic
1138186420 16:54981202-54981224 CTGTTTCTTCATCTGTAAGGGGG + Intergenic
1139344702 16:66295293-66295315 TGGTTTTGTCATCTGTGAAGTGG + Intergenic
1141685176 16:85566023-85566045 CTGTTTTCTCATCTGCTAAATGG + Intergenic
1141929831 16:87194960-87194982 CTGTTTTCTCATCTGCAAAATGG - Intronic
1142123863 16:88400590-88400612 CTGTTTTCACAGCTGAGAGGAGG - Intergenic
1142753779 17:2003576-2003598 CAGTTTTGTCATCTGAAAAGTGG - Intronic
1145888971 17:28401672-28401694 CTGTTTCTTCATCTGTGATGTGG - Exonic
1146465712 17:33084566-33084588 CAGTTTTGTCATCTGCAAAGTGG + Intronic
1146618112 17:34372795-34372817 CAGTTTTCTCATCTGCAAAGTGG - Intergenic
1147048850 17:37775695-37775717 CTATTTTCTCATCTGTGAAGTGG + Intergenic
1147246822 17:39127188-39127210 CTGTTTCCTCATCTGTAAGGTGG - Intronic
1147882571 17:43663473-43663495 CGGTTTTGTCATCTGCAAAATGG - Intergenic
1148049631 17:44763271-44763293 CTGTTTCTCCATCTGCGAGATGG - Intronic
1148235514 17:45965898-45965920 CTCCTTTGTCATCTGTGAAGCGG - Intronic
1148469163 17:47882875-47882897 CAGTTTTCTCATCTGCAAAGTGG + Intergenic
1148685453 17:49498054-49498076 CTGTTTCCTCAACTGCGAAGTGG - Intronic
1148738275 17:49877234-49877256 CTGTTTTCTCATCTGTGAAACGG + Intergenic
1149562110 17:57615451-57615473 CTGTTTTCTCATCTGTGAACTGG + Intronic
1150289902 17:63975086-63975108 CTGTTTTGTAATGTGAGGGGAGG + Intergenic
1150463960 17:65376072-65376094 CAGTTTTGTCATCTGTAAGAAGG - Intergenic
1152580347 17:81163019-81163041 CTGTTTTGTCATCTGTAAGGTGG - Intronic
1153000944 18:454793-454815 CTGTCTTCTCATCTGCCATGAGG + Intronic
1153813660 18:8774890-8774912 CTGTTCTGTGATTTGCTAGGAGG + Intronic
1153996103 18:10442803-10442825 CTCTTTTGTCATCTGTGTTGAGG + Intergenic
1154285727 18:13054616-13054638 CTGTTTCTTCATCTGTAAGGAGG + Intronic
1154305665 18:13229067-13229089 CTGTTCTGCCATCTGCATGGAGG + Intronic
1154352871 18:13601424-13601446 CTGTTTTGACTGCTGTGAGGTGG - Intronic
1156497057 18:37532740-37532762 CAGTTTTCTCATCTGCCAAGTGG + Intronic
1157192186 18:45590892-45590914 CAATTTTGTCATCTGCAAGATGG - Intronic
1158188487 18:54798376-54798398 CTGTTTTGTCATCAGCAAAATGG - Intronic
1158660345 18:59381581-59381603 CTGTTTTCTCATCTATAAGGTGG + Intergenic
1160915977 19:1496781-1496803 ATGTTTTGTCATGTGCAAGAGGG + Intronic
1162867773 19:13561842-13561864 CTGATTTGCCATCTGCAAGCTGG - Intronic
1162968999 19:14169064-14169086 CTGTTTATTCATCTGTGATGGGG - Intronic
1163243455 19:16077639-16077661 CTTTTTTCCCATCTGCGAGTAGG + Intronic
1163277082 19:16291569-16291591 CAGTTTTGTCATCTGAGAAATGG - Intergenic
1163456063 19:17406312-17406334 CTGTTTCTTCATCTGCAAAGGGG + Intronic
1164267492 19:23633154-23633176 CTGGTTTGTCTCCTGCCAGGAGG - Intronic
1165328514 19:35127801-35127823 TTGTTTTCTCATCTGCGAAGGGG - Intronic
1165393703 19:35552484-35552506 CTGTTTTCTCACCTGCAAAGTGG - Intronic
1165929695 19:39348999-39349021 CTGTTTTGTCATCTGTAATGTGG - Intronic
1166269550 19:41705593-41705615 CTGATGTGTCACCTGGGAGGAGG - Intronic
1166721569 19:44999940-44999962 CAGTTTTCTCATCTGCTATGTGG + Intergenic
1167135244 19:47611718-47611740 CTGTTTTCTCATCTGCAAGTGGG + Intronic
1202699192 1_KI270712v1_random:150653-150675 CTGTTTTGTCATCAGTGGGGTGG + Intergenic
926625022 2:15083908-15083930 CTGTTTTGACATCTGTGAAATGG + Intergenic
927152719 2:20204981-20205003 CTGTTTTCTCATCTGCAAAATGG - Intronic
927211219 2:20640373-20640395 CAGTTTTCTCATCTGTAAGGTGG - Intronic
928404189 2:31002073-31002095 CAGTTTTTTCATCTGTGAAGTGG - Intronic
928614238 2:33020623-33020645 CTGTTTTTTCATCTGTAAAGTGG + Intronic
931450636 2:62365027-62365049 CTCTTTTGACAACTGAGAGGGGG + Intergenic
932287633 2:70550362-70550384 CAGTTTTGTCATCTGTAAAGTGG - Intronic
932320081 2:70815620-70815642 CACTTTTCTCATCTGCAAGGGGG - Intronic
932794385 2:74681956-74681978 CAGTTTACTCATCTGCGAAGTGG + Exonic
932800079 2:74733873-74733895 CTGTTTTCTCATCTGGGAAAGGG + Intergenic
932958066 2:76379084-76379106 GTGTTTTCTCATCTGTGAAGAGG - Intergenic
933586678 2:84186924-84186946 CAGTTTTGTCATCTGCAAAATGG - Intergenic
934122270 2:88851970-88851992 CAGTTTTCTCATCTGAAAGGGGG - Intergenic
934170141 2:89534138-89534160 CTGTTTTGTCATCAGTGGGGTGG + Intergenic
934280443 2:91608446-91608468 CTGTTTTGTCATCAGTGGGGTGG + Intergenic
935558881 2:104540949-104540971 CTCCTTTGACATCTGAGAGGAGG + Intergenic
936453019 2:112647176-112647198 ATGTTTTGTCCTCTTCGTGGTGG + Intronic
936479018 2:112868085-112868107 CTGTTTTCTCACCTGAGAGATGG + Intergenic
936582304 2:113712140-113712162 CTTATTTGTCAGCTGCCAGGGGG + Intronic
937219055 2:120331095-120331117 CTGTTTCCTCATCTGCAAAGAGG + Intergenic
937689418 2:124737841-124737863 TTGTTTTCTCATCTGCAAAGGGG + Intronic
939869760 2:147513886-147513908 CTGTTTTCTCATCTGTAAAGTGG + Intergenic
942175990 2:173335136-173335158 CTGTTTTGTTTTTTGAGAGGGGG + Intergenic
942516085 2:176754846-176754868 CAGTTTTCTCATCTGGGAAGTGG + Intergenic
943257846 2:185618991-185619013 CTTTTTAGTCTTCTGAGAGGTGG + Intergenic
943673832 2:190696950-190696972 CTGTTTTCTCATCTGCAAAATGG - Intergenic
945003359 2:205376169-205376191 CTGTTTTTTCATCTGTGAGGTGG - Intronic
946615452 2:221504784-221504806 CTGTTTCTTCATCTGCAAAGTGG - Intronic
948635293 2:239330616-239330638 CTGTTTTCTTATCTCAGAGGAGG + Intronic
948893902 2:240919450-240919472 CTGTTTCCTCAGCTGCCAGGTGG - Intronic
949009634 2:241671187-241671209 CTGTTTTCTCATCAGTGAGATGG + Intronic
1168790637 20:573572-573594 CGATTTTCTCATCTGTGAGGTGG + Intergenic
1168869703 20:1117977-1117999 CCGTTTTGTCATCTGCAAAATGG + Intronic
1168928828 20:1604805-1604827 CTCTCAAGTCATCTGCGAGGTGG - Intronic
1168932627 20:1636251-1636273 CTCTCAGGTCATCTGCGAGGTGG - Exonic
1168969552 20:1921627-1921649 CTCTCAAGTCATCTGCGAGGTGG + Exonic
1168976433 20:1969538-1969560 CTGTTTTCTTATCTGCAAGACGG + Intergenic
1168979870 20:1995263-1995285 CTGTTTTCTCATCTGCAAGATGG - Intergenic
1169045027 20:2528315-2528337 CCGTTTTTTCATCTGCTGGGTGG - Intergenic
1169487888 20:6048562-6048584 CAGTTTTTTCATCTGCGAAATGG + Intronic
1169685201 20:8263128-8263150 CAGTTTTGTCATCTGTTAGATGG + Intronic
1169871069 20:10248976-10248998 CTGTTTTTTCATCTGTGAAGCGG - Intronic
1170143301 20:13146930-13146952 CTGTTTCCTCATCTGTGAAGTGG + Intronic
1172183231 20:33016234-33016256 CGGTTTTCTCATCTGTAAGGTGG - Intronic
1172196764 20:33097223-33097245 CTGTTTTCTCATCTGTAATGTGG + Intronic
1172272362 20:33661993-33662015 CTGTTTTCTCATCTGCAAAATGG - Intronic
1172803268 20:37593257-37593279 CTGTTTCCTCATCTGCAAGATGG - Intergenic
1173571661 20:44081032-44081054 CAGTTCTGCCATCTGCGAGTAGG + Intergenic
1173748512 20:45457053-45457075 CTGTTTTCTCCTCTGTAAGGTGG + Intergenic
1173934777 20:46851829-46851851 CTGTTTTCTCATCTTCAAGATGG - Intergenic
1174290172 20:49502726-49502748 CAGTTTCCTCATCTGTGAGGAGG - Intergenic
1174688653 20:52480495-52480517 GTTTTTTCTCATCTGCAAGGTGG + Intergenic
1174700534 20:52603966-52603988 CAGTTTTATCATTTGCAAGGGGG - Intergenic
1174815493 20:53683679-53683701 CTGTTTTCTCATCTGTGAAATGG - Intergenic
1175053453 20:56176528-56176550 CTGTTTTCTCATCTGCAGGATGG - Intergenic
1175206316 20:57314460-57314482 CAGTTTTCTCATCTGTGAAGTGG - Intergenic
1175310676 20:58009642-58009664 CTGTTTTGTCATCTGTGTGTTGG + Intergenic
1175458194 20:59130913-59130935 CTGTTTCCTCATCTGAAAGGAGG + Intergenic
1175615583 20:60395307-60395329 CTCTTTTGTCATCTGTGAAACGG + Intergenic
1177782683 21:25637852-25637874 CAGTTTTCTCATCTGCAAAGTGG + Intergenic
1181880738 22:25977855-25977877 CAGTTTTCTCATCTGCAAAGTGG - Intronic
1181901822 22:26162271-26162293 CTGTTTACTCATCTGCGAAGTGG + Intergenic
1181941938 22:26484339-26484361 CAGTTTTCTCATCTGTGAGATGG + Intronic
1182096980 22:27632778-27632800 CAGTTTCCTCATCTGCAAGGTGG - Intergenic
1182330757 22:29550196-29550218 CAGTTTTGTCATCTGTGAAATGG - Intronic
1182430555 22:30296313-30296335 CAGTTTTCTCATCTGCGAACAGG - Intronic
1182439606 22:30355328-30355350 CAGTTTTGTCATCTGTAATGTGG - Intronic
1182470111 22:30543237-30543259 CTCTCAAGTCATCTGCGAGGTGG + Intronic
1183278727 22:36920067-36920089 CTGTTTTCTCATCTACGAAGTGG + Intronic
1183518490 22:38282291-38282313 CAGTTTCCTCATCTGCCAGGTGG - Intergenic
1184036138 22:41919236-41919258 CAGTTTTGTCATCTGCAAGATGG + Intergenic
1184150869 22:42637756-42637778 CTGTTTCCTCATCTGCGAAATGG - Intronic
1184422933 22:44392283-44392305 CAGTTTTCTCATCTGTAAGGTGG + Intergenic
1184451176 22:44583800-44583822 TTGTTTTGTCCTCTGGGAAGGGG - Intergenic
1184479596 22:44738747-44738769 CAGTTTTGTCATCTGTGATACGG + Intronic
1184507536 22:44913496-44913518 CTGTTTGCTCATCTGTAAGGTGG - Intronic
1185019474 22:48365746-48365768 CTGTTTTTTCATCTGTGAAATGG + Intergenic
949632183 3:5940482-5940504 CAGTTATGTCATCTGCAAAGAGG + Intergenic
949933982 3:9102283-9102305 CAGTTTTGTCATCTGGGAAATGG - Intronic
950131160 3:10547591-10547613 CTGTTTTCTCATCTGTGAAATGG - Intronic
950161744 3:10765590-10765612 CTATTTTCTCAGCTGGGAGGTGG - Intergenic
950202134 3:11052431-11052453 CTGTTTTGCCATCTGGGGGCTGG - Intergenic
950317320 3:12014797-12014819 CTGTTTTTTCAACTGCAAAGTGG + Intronic
950528890 3:13540919-13540941 CAGTTTTGTTATCTGTGAAGTGG + Intergenic
951421235 3:22488131-22488153 CTGTTTTGTCAGCTGCTGTGTGG - Intergenic
952663936 3:35881606-35881628 CTATTTTGTCTTTTGGGAGGTGG - Intergenic
953351969 3:42222669-42222691 CTGTTTCTTCATCTGCAAAGGGG + Intronic
953658386 3:44872010-44872032 CTGTTTCTTCATCTGGGAGGTGG - Intronic
953681498 3:45042132-45042154 CTGTTTTCCCATCTGGCAGGTGG + Intergenic
954706319 3:52482541-52482563 CTGTTTTCTCAACTGTGAAGTGG + Intronic
955026814 3:55175570-55175592 CTGTTTTCTCATCTGCAAAAAGG - Intergenic
955632441 3:60989121-60989143 CTGTGTTGTCATCTTCATGGGGG - Intronic
955705220 3:61720533-61720555 CTGTTTTTTCATCTGGGAGTTGG - Intronic
956117443 3:65932705-65932727 CTGATTTTCCATCTACGAGGTGG - Intronic
956567622 3:70656611-70656633 CTGGTTTGTCACCCGCGCGGCGG - Intergenic
960246549 3:115406156-115406178 CTGTCTTGTCATCTGTGAAATGG - Intergenic
961408306 3:126699030-126699052 CGGTTTTCTCATCTGTGAAGTGG + Intergenic
961437629 3:126930536-126930558 TTGTTCTGTCTTCTGGGAGGTGG + Intronic
961717039 3:128864826-128864848 CAGTTTTGTCATCTGAAAGGGGG - Intergenic
961804862 3:129482128-129482150 ATGTTTTGTCATCTGAAAGGGGG + Intronic
961807579 3:129500403-129500425 CTGTTTCATCATCTGCAAGGTGG - Intronic
962353267 3:134671864-134671886 CTGTTTTCTCATCTGTGAAATGG + Intronic
962752745 3:138445826-138445848 CAGCTTTCTCATCTGCGAGATGG - Intronic
963079981 3:141382464-141382486 CTGTTTGGTCACCTGTGAGAGGG + Intronic
964559967 3:157983516-157983538 CTGTTTTCTCATCTGCAAAGTGG + Intergenic
967619040 3:191609544-191609566 CTGTTTTGCTATCTGCCAGGAGG - Intergenic
967651390 3:191990523-191990545 CTGTTTGGCCTTCTGCTAGGAGG - Intergenic
967876585 3:194271843-194271865 CTGTTTTTTCAGCTGCGCCGTGG + Intergenic
968952482 4:3702181-3702203 CTGTTCTGTCATCTGCAAGTGGG - Intergenic
969089464 4:4682816-4682838 CAGTTTCCTCATCTGGGAGGTGG + Intergenic
969125067 4:4941250-4941272 CTGTTTTCTCATATAAGAGGGGG - Intergenic
969210287 4:5682023-5682045 CTGTTTTCTCATCTGTGAAATGG + Intronic
969243932 4:5920291-5920313 CTGTTTTTACATCTGTGAGGAGG + Intronic
969665909 4:8557599-8557621 CAGTTTTCTCATCTGTGAAGTGG + Intergenic
969672616 4:8598109-8598131 CTCTTTTGTCATCTGTGATGAGG + Intronic
969694854 4:8728729-8728751 CTGTTTCCTCATCTGTGAAGAGG + Intergenic
971481491 4:27118690-27118712 CTGTTTTGTCATCTGTAAAATGG - Intergenic
971751312 4:30652456-30652478 CAGTTTTTTCATCTGCATGGTGG + Intergenic
972565160 4:40263019-40263041 CAGTTTTGTCATCTGTGAAATGG + Intergenic
972927046 4:44022509-44022531 TTGTTTTGACATCTGGGTGGTGG + Intergenic
972958218 4:44418751-44418773 CTGTCTTCTCATCTGTGAAGTGG + Intronic
974115497 4:57574336-57574358 CTGTTATGTCATTTGAGAGTGGG - Intergenic
975661624 4:76694637-76694659 CTGTTTCCTCATCTGCAAGATGG + Intronic
975691772 4:76972362-76972384 CTGTTTTGTCTTTTGCTTGGTGG + Intronic
977255672 4:94737361-94737383 CAGTTTTCTCATCTGCAAAGAGG + Intergenic
978092433 4:104734387-104734409 TGGTTTTGACATCTGTGAGGTGG + Intergenic
986264359 5:6180261-6180283 CTGTTTTCTCATCTGCAAATTGG - Intergenic
986322585 5:6644976-6644998 ATGTTGTGTCATCAGTGAGGTGG - Intronic
986681831 5:10240552-10240574 CTGTTTTCTCATCTGCAAAGTGG + Intronic
987272268 5:16323659-16323681 CAGTTTTCTCATCTGCAAAGGGG - Intergenic
990948040 5:61270230-61270252 CCCTTTTGTCATCTGCAAAGTGG + Intergenic
991008950 5:61861415-61861437 CAGTTTTCTCATCTGTGAGATGG - Intergenic
992138655 5:73773159-73773181 CTCTGTTGTCATCTTCCAGGCGG - Intronic
996171840 5:120303093-120303115 CTGTTCTGTCATCTGAGAAAGGG + Intergenic
997048127 5:130344917-130344939 TTGTTTTGTCTTTTGTGAGGCGG + Intergenic
997429940 5:133830612-133830634 CGGTTTTTTCATCTGGGAAGTGG - Intergenic
998011112 5:138696465-138696487 CTGTTTCTTCATCTGTTAGGTGG - Intronic
998378365 5:141706429-141706451 CTGTTTTCTCATTTGGTAGGTGG - Intergenic
998526415 5:142847112-142847134 CTGTTTTCTCATCTGTGAAACGG + Intronic
999205548 5:149845463-149845485 CTCTTTCCTCATCTGCAAGGTGG + Intronic
999258220 5:150221734-150221756 TTTTTTTGTCATCTCTGAGGTGG - Intronic
999707256 5:154284885-154284907 CAGTTTTGTCATCTACAAAGTGG + Intronic
1000253339 5:159515446-159515468 CTGTTTTCTCAGCTGTGAAGTGG - Intergenic
1000353091 5:160367965-160367987 CTGTTTTCTCTTCTGCCAAGTGG - Intronic
1001143904 5:169167647-169167669 CAGTTTTGTCATCTGTGAAATGG - Intronic
1001222033 5:169908911-169908933 CTGTTTTCTCATCTGCAAAATGG - Intronic
1001677827 5:173533118-173533140 CTGTTTTGTCATCTGCAGATGGG + Intergenic
1001769587 5:174283225-174283247 CTGTGGTTTCATCTGGGAGGGGG + Intergenic
1001913815 5:175542791-175542813 CTGTTTTCTCATCTGCAAATGGG + Intergenic
1002957947 6:1887042-1887064 CTGTTTTCTCATCTGTGAAATGG - Intronic
1005298141 6:24446489-24446511 CTGTTTTTTCTTTTGGGAGGAGG - Intronic
1006505521 6:34486370-34486392 CTGTTTTCTCATCTTCAAAGCGG - Intronic
1006561871 6:34920141-34920163 CTGTTTTGTCATAAGTAAGGAGG + Intronic
1006627387 6:35406968-35406990 CACTTTTGTCATCTGCAAGGGGG + Intronic
1007141938 6:39584711-39584733 CAGTTTTGTCATCTTTAAGGTGG + Intronic
1007408393 6:41647706-41647728 CTGTTTTCTCATCTGTGAAATGG + Intronic
1008765712 6:54911538-54911560 GTATTGTGTCATCTGAGAGGAGG - Intronic
1009038057 6:58142078-58142100 CAGTTTTGTCATTTGCAAAGTGG + Intergenic
1009498206 6:64376559-64376581 CTATTTTGTTTTCTGAGAGGTGG + Intronic
1009901826 6:69816658-69816680 TTTTTTTCTCATCTGCAAGGCGG - Intergenic
1010316120 6:74452348-74452370 CTGTTGTGTGTTCTGTGAGGGGG + Intergenic
1010897657 6:81384625-81384647 CTGTTTTCTCATCTGTTAGATGG + Intergenic
1011263755 6:85494430-85494452 CAGTTTTTTCATCTGACAGGTGG - Exonic
1015234524 6:130955356-130955378 GTATGTTGTCATCTGCAAGGTGG - Intronic
1016312972 6:142754456-142754478 CTGTTTTGTCATCTGTTCTGTGG - Intronic
1016835102 6:148469243-148469265 CAGTTTTCTCATCTGCTAGGTGG + Intronic
1017142967 6:151208301-151208323 CTGTTTTATCATGTGTGAAGTGG - Intergenic
1017405813 6:154117010-154117032 CTGTTTGCTCATCTGTGGGGTGG - Intronic
1018789667 6:167137594-167137616 CTGTTTTGTGAAATGCCAGGCGG - Exonic
1019557940 7:1641874-1641896 CTGTTTTCTCATCTGTGAAAGGG + Intergenic
1021146816 7:17099383-17099405 CCGTTTTCTCATCTGCTAAGCGG + Intergenic
1021180955 7:17505142-17505164 CTGTTTTCTCATCTTCCAGTAGG + Intergenic
1025211641 7:57022528-57022550 CAGTTTTTTCATCTGCAAAGTGG - Intergenic
1025660315 7:63554299-63554321 CAGTTTTTTCATCTGCAAAGTGG + Intergenic
1026773266 7:73215287-73215309 CTGTTTTCCCATCTGTGAAGTGG + Intergenic
1027014126 7:74768683-74768705 CTGTTTTCCCATCTGTGAAGTGG + Intergenic
1027073908 7:75177349-75177371 CTGTTTTCCCATCTGTGAAGTGG - Intergenic
1028140720 7:87272228-87272250 AGGTTATGTCATCTGCGACGAGG + Intergenic
1029674861 7:102061528-102061550 CAGTTTTTTCATCTGCAAAGTGG - Intronic
1029870557 7:103687445-103687467 CTGTTTTTTCATCTGTGAAATGG + Intronic
1030083047 7:105793849-105793871 CTGTTTTCTCATCTGAAAGATGG - Intronic
1032731465 7:134647156-134647178 CCGTTCTGTCAACTGAGAGGAGG + Intronic
1032978973 7:137259444-137259466 CTGTTTTGACATCTGCAAAATGG + Intronic
1032997444 7:137463806-137463828 CAGTTTTCTCATCTGTGAAGGGG - Intronic
1034354963 7:150444471-150444493 CAGTTTTGTCATCTGTGTGATGG - Intergenic
1036403575 8:8432820-8432842 CTGTATTGTCATCTCTGTGGTGG - Intergenic
1036495375 8:9265537-9265559 CAGTTTTCTCATCTGCAAAGTGG + Intergenic
1037268061 8:17090071-17090093 CTGTTTTCTCATCTCCAAGCAGG - Intronic
1037591393 8:20315051-20315073 CAGTGTTCTCATCTGCGAAGTGG - Intergenic
1040046228 8:42966754-42966776 CTGTTTTCTCATCTGCAAAATGG + Intronic
1040575125 8:48645386-48645408 CTGTTTCCTCATCTGCAAGGTGG + Intergenic
1043174209 8:77003389-77003411 CTGTTTCCTCATCTGTGAGTGGG - Intergenic
1044553961 8:93542077-93542099 CTGTTTCTTCATCTGTAAGGTGG - Intergenic
1045137740 8:99240147-99240169 ATGTTTTGTCAACTGCCAGGTGG + Intronic
1045361861 8:101440396-101440418 CTGCTTTGTCATCAGCATGGTGG - Intergenic
1047689431 8:127336188-127336210 CAGTTTTCTCATTTGTGAGGTGG - Intergenic
1049206715 8:141366994-141367016 CTGTTTTCTCATCTGAGAAATGG + Intronic
1049267184 8:141674485-141674507 CGGTGTTCTCATCTGCGAAGTGG - Intergenic
1050828195 9:9976232-9976254 CTATTTTGTAAACTGGGAGGGGG - Intronic
1050981114 9:12017621-12017643 CTGTTATGTGTTCTGAGAGGGGG - Intergenic
1051347113 9:16162202-16162224 CTGTTTCATCATCTGTGAGATGG - Intergenic
1051502593 9:17794186-17794208 CTGTTGTGTAATCTGCGTGTAGG - Intronic
1051688108 9:19679755-19679777 CAGTTTTGCCATCTGCAAGATGG - Intronic
1052438056 9:28455928-28455950 CTATTTTCTCATTTGCCAGGTGG + Intronic
1052863939 9:33453662-33453684 CAGTTTTGTCATCTGTGAAATGG - Intergenic
1053268236 9:36731492-36731514 CTGTTTTCTCATCTGTAAAGTGG - Intergenic
1053272838 9:36762001-36762023 CTGTTTTCTTATCTGTGAAGTGG + Intergenic
1053304485 9:36974463-36974485 CTGTTTTCTCATCTGTAAAGTGG - Intronic
1053389719 9:37725759-37725781 CTGTTTTCTCTTCTGCAAAGTGG - Intronic
1055355572 9:75433916-75433938 CAGTTTTCTCATCTGTGATGTGG - Intergenic
1055740906 9:79388016-79388038 CTGTTTTGTCTTCTGCCACGTGG - Intergenic
1056448366 9:86688853-86688875 CAGTTTTGTCATCTGCAAAATGG - Intergenic
1056840003 9:89991148-89991170 CTGTTTTCTCATCTGCAACATGG + Intergenic
1056975095 9:91245736-91245758 CCGTTTTCTCATCTGTGTGGAGG - Intronic
1057299377 9:93868523-93868545 CAGTTTTCTCATCTGTAAGGTGG + Intergenic
1057704735 9:97388610-97388632 CTGTTTTCTCATCTGAAAAGTGG - Intergenic
1057900972 9:98947970-98947992 CTGTTTTCCCATCTACGAAGTGG + Intronic
1058575231 9:106393893-106393915 CTGTTTTACCATGTGAGAGGAGG + Intergenic
1058961572 9:109997286-109997308 CTGTTTTCTCATCTGCAGAGCGG + Intronic
1059660162 9:116392401-116392423 CTATTTTCTCATCTGCAAGATGG + Intronic
1059873153 9:118601004-118601026 CTGTTTTCTCATCTGCAAGATGG + Intergenic
1060048596 9:120360293-120360315 CTGTTTCCTCATCTGCAAGAGGG - Intergenic
1060114198 9:120928136-120928158 CAGTTTTCTCATCTGTAAGGTGG - Exonic
1060442335 9:123653556-123653578 CTGTTTTCTCATCTTCGTAGAGG - Intronic
1061056703 9:128226538-128226560 CTGTTTTGCCATCTGCAAAATGG - Intronic
1061250247 9:129422153-129422175 CAGTTTTGTCATCTGCCAAATGG - Intergenic
1061495446 9:130971321-130971343 CTGTTTTCTCATCTGGAAGTGGG + Intergenic
1061667277 9:132167936-132167958 CTGTTCTGTCATCTGCAAAATGG + Intronic
1062617489 9:137404380-137404402 CAGTTTTCTCATCTGGGAGATGG - Intronic
1186219415 X:7333746-7333768 CTGTTTTCTCATCTGTGCAGTGG + Intronic
1186719223 X:12284882-12284904 CAGTTTTCTCATCTGCGAAATGG + Intronic
1189241911 X:39531703-39531725 CAGTTTTGTCATCTGTAAGATGG - Intergenic
1190107016 X:47568350-47568372 CTGCTTTCTCATCTGTGAGATGG + Intronic
1190730294 X:53221393-53221415 CTGTTTTCTCATCTGTGAGGTGG + Intronic
1191754449 X:64579380-64579402 CAGTTTTCTCATCTGTGAAGTGG + Intergenic
1192256691 X:69467173-69467195 CAGTTTTGCCATCTGTGAAGTGG - Intergenic
1192630692 X:72776000-72776022 CCGTTTTGTTATGTGTGAGGAGG + Intergenic
1192651018 X:72944804-72944826 CCGTTTTGTTATGTGTGAGGAGG - Intergenic
1193680937 X:84518440-84518462 CTGGTTGGTCTTCTGCCAGGAGG + Intergenic
1195151640 X:102077154-102077176 TTGTTTTGTCATCTGCTTTGAGG - Intergenic
1197275140 X:124469406-124469428 CTGTTTTGTCATCTGTAAAATGG - Intronic
1198395237 X:136213062-136213084 CTGTTTTCTCATCTGGGAAACGG - Intergenic
1200747285 Y:6913357-6913379 CGGTTTTCTCATCTGTGAGATGG + Intronic
1201392780 Y:13516365-13516387 CTGTCATGTCATCTGCAAAGAGG + Intergenic