ID: 1074768175

View in Genome Browser
Species Human (GRCh38)
Location 10:116715993-116716015
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768175_1074768185 18 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG No data
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768175_1074768184 17 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG No data
Right 1074768184 10:116716033-116716055 GAGCAGCTCCCACTCTGGGATGG No data
1074768175_1074768183 13 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG No data
Right 1074768183 10:116716029-116716051 AGCTGAGCAGCTCCCACTCTGGG No data
1074768175_1074768182 12 Left 1074768175 10:116715993-116716015 CCCCCTCGCAGATGACAAAACAG No data
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074768175 Original CRISPR CTGTTTTGTCATCTGCGAGG GGG (reversed) Intronic