ID: 1074768176

View in Genome Browser
Species Human (GRCh38)
Location 10:116715994-116716016
Sequence TCTGTTTTGTCATCTGCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768176_1074768182 11 Left 1074768176 10:116715994-116716016 CCCCTCGCAGATGACAAAACAGA No data
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data
1074768176_1074768185 17 Left 1074768176 10:116715994-116716016 CCCCTCGCAGATGACAAAACAGA No data
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768176_1074768184 16 Left 1074768176 10:116715994-116716016 CCCCTCGCAGATGACAAAACAGA No data
Right 1074768184 10:116716033-116716055 GAGCAGCTCCCACTCTGGGATGG No data
1074768176_1074768183 12 Left 1074768176 10:116715994-116716016 CCCCTCGCAGATGACAAAACAGA No data
Right 1074768183 10:116716029-116716051 AGCTGAGCAGCTCCCACTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074768176 Original CRISPR TCTGTTTTGTCATCTGCGAG GGG (reversed) Intronic
No off target data available for this crispr