ID: 1074768177

View in Genome Browser
Species Human (GRCh38)
Location 10:116715995-116716017
Sequence ATCTGTTTTGTCATCTGCGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 134}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768177_1074768183 11 Left 1074768177 10:116715995-116716017 CCCTCGCAGATGACAAAACAGAT 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1074768183 10:116716029-116716051 AGCTGAGCAGCTCCCACTCTGGG No data
1074768177_1074768182 10 Left 1074768177 10:116715995-116716017 CCCTCGCAGATGACAAAACAGAT 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data
1074768177_1074768185 16 Left 1074768177 10:116715995-116716017 CCCTCGCAGATGACAAAACAGAT 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data
1074768177_1074768184 15 Left 1074768177 10:116715995-116716017 CCCTCGCAGATGACAAAACAGAT 0: 1
1: 0
2: 2
3: 11
4: 134
Right 1074768184 10:116716033-116716055 GAGCAGCTCCCACTCTGGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074768177 Original CRISPR ATCTGTTTTGTCATCTGCGA GGG (reversed) Intronic
901418451 1:9133786-9133808 TTCTGTTTTGTTTTTTGCGAAGG + Intergenic
904501559 1:30915658-30915680 CTCAGTCTCGTCATCTGCGAAGG + Intergenic
906543622 1:46606608-46606630 ATCTATTTTGTTATCAGTGATGG - Intronic
907964805 1:59318650-59318672 ATCTGTCTTGTCATCGGGGCTGG + Intronic
908458343 1:64325867-64325889 ATCAGTTTTCTAATCTGCAAAGG - Intergenic
911888405 1:103334008-103334030 TTCAGTTTTCTCATCTGCAATGG + Intergenic
913542849 1:119838515-119838537 ATGTCTCTTGTCAGCTGCGATGG - Intergenic
914959350 1:152192557-152192579 ATCTGTTCTGTCCTCTTCCAAGG + Intergenic
916096348 1:161354705-161354727 GTGTGTTTTGTCATTTGAGATGG + Intronic
916922460 1:169483702-169483724 ATCTGTTTTGTCATGTGCTCTGG - Intronic
918875532 1:190037005-190037027 AACTGTTTTGTGACCTGTGAGGG + Intergenic
921684049 1:218069819-218069841 ATCAGTTTTCTCATCTTCAAAGG - Intergenic
922323033 1:224504193-224504215 CTCTGTTTTCTCACCTGGGAGGG + Intronic
923417733 1:233780650-233780672 ATCTGTTTTCTCTTCTGGGCTGG - Intergenic
1064062502 10:12149981-12150003 AACTGTTTTGTTATCTGCATAGG - Intronic
1069099218 10:64297029-64297051 ATCTGTTTCCTCCTCTGCAATGG + Intergenic
1069935474 10:71912695-71912717 ATCTGTATGGTCATCTGCACAGG + Intergenic
1074768177 10:116715995-116716017 ATCTGTTTTGTCATCTGCGAGGG - Intronic
1077453820 11:2666131-2666153 TTCTGTTTTGGCATCTTAGATGG + Intronic
1081352314 11:42069378-42069400 ATCTGTTTTCTCATCTAAAATGG + Intergenic
1082600312 11:55142425-55142447 ATCTTTTTTATTATCTGCAAAGG - Intergenic
1082641614 11:55667876-55667898 ATATCTTTTGTCTTCTGCCAGGG - Intergenic
1082891325 11:58141961-58141983 ATATGTTTTGTAATCAGAGAAGG + Intronic
1088120721 11:106365676-106365698 ATCAGTTTACTCATCTGTGAAGG + Intergenic
1089707382 11:120289512-120289534 AACTCTTTTGTCTTCTGCCATGG + Intronic
1090582786 11:128178334-128178356 ATCTGTTCTCTAATCTGCTATGG + Intergenic
1091736086 12:2923196-2923218 TTCAGTTTTCTCATCTGCAAAGG - Intronic
1093298427 12:17421014-17421036 TTCTGTTTTGTCACCTGTTATGG + Intergenic
1093919207 12:24840557-24840579 ATCTGGTTTTTCATATGCCAAGG + Intronic
1094863399 12:34498008-34498030 CTGTTTTTTGTTATCTGCGAAGG - Intergenic
1099293944 12:80806519-80806541 ATATGTTTTTTTATCTGAGATGG - Intronic
1100313418 12:93419656-93419678 ATCAGTTTTTTCATTTGCAAAGG - Intronic
1104260210 12:127175254-127175276 TTCTCTTTTGTCCTCTGCCAAGG + Intergenic
1105374035 13:19826859-19826881 ATCTATTCTTTCATCTGTGATGG - Intronic
1108852863 13:54756385-54756407 ATCTGTTTTATCACATGCAAGGG - Intergenic
1110065029 13:71093498-71093520 ATCTTTTTTTTCATCTAAGAAGG - Intergenic
1112717147 13:102200056-102200078 CTCAGTGTTGTCATCTGTGATGG + Intronic
1112816029 13:103274670-103274692 CTCAATTTTGTCATCTGCTAAGG + Intergenic
1113616547 13:111684710-111684732 ATCTGTTTTGGGTTCTGAGATGG + Intergenic
1113622077 13:111769981-111770003 ATCTGTTTTGGGTTCTGAGATGG + Intergenic
1115255107 14:31392391-31392413 TTCTGTTTTGTCTTCTTCAATGG + Intronic
1115517688 14:34202391-34202413 ATCTCTTTTGTAATCTGCGTAGG + Intronic
1116100423 14:40426777-40426799 TTCTGGTTTTTCATCTGCTAAGG + Intergenic
1117528360 14:56634507-56634529 AACTGTTTTATCATCTGACAAGG - Intronic
1122244897 14:100395453-100395475 CTCAGTTTTGTCATCTGTAAAGG - Intronic
1123808816 15:23902685-23902707 ATTTGTTTTTTCATCTGACAAGG - Intergenic
1125430473 15:39588561-39588583 ATCTGTTCTGTCACCTGTGGAGG + Exonic
1130570965 15:85043354-85043376 ATCAGTTTTGTCTTTTGGGAGGG + Intronic
1133806082 16:9126851-9126873 CTCAGTTTTCTCATCTGTGAAGG + Intergenic
1134436638 16:14264936-14264958 AGCTGTTTTGTCAACTGCTATGG - Exonic
1134938808 16:18270321-18270343 ATCTCTTTTGTCATCAGGAAGGG + Intergenic
1140438619 16:74969275-74969297 ATTTGTTTTGTCTTTTGAGACGG + Intronic
1140786027 16:78342956-78342978 ACCTTTATTGTCATCTGCAAGGG - Intronic
1141385348 16:83617998-83618020 ATCTGTTTTGTCATCTGCTGTGG + Intronic
1142112914 16:88341667-88341689 CTCGGTTTTGCCATCTGCGGGGG + Intergenic
1146129727 17:30260984-30261006 ATTTGTTTTGTCACCTCAGAGGG - Intronic
1146364328 17:32207893-32207915 GTCTGTTTTGTCATCAGCATTGG + Intronic
1149301222 17:55305889-55305911 CTCTGTTTTTCCATCTGCGTGGG + Intronic
1203165945 17_GL000205v2_random:95580-95602 ATCTGTTTGGTTATCTACAATGG + Intergenic
1155080239 18:22402352-22402374 ATCTATTGTCTCCTCTGCGAAGG + Intergenic
1162174231 19:8819187-8819209 ATTTTTTTTGTCTTCTGAGACGG + Intronic
1162821206 19:13224728-13224750 GACGGTGTTGTCATCTGCGACGG + Exonic
1164856470 19:31528475-31528497 ATCTGTTATGGCATCTGCATGGG - Intergenic
1165328516 19:35127803-35127825 CTTTGTTTTCTCATCTGCGAAGG - Intronic
1166820681 19:45577699-45577721 ATTTGTTCTGTCATTTGTGATGG - Intronic
1168131680 19:54325095-54325117 ATTTTTTTTCTCATCTGGGAGGG + Intergenic
926060405 2:9801377-9801399 TTCTGTTTGGGCTTCTGCGAAGG - Intergenic
930524765 2:52514307-52514329 ATCTGTTTTTTCAGATGCCAAGG - Intergenic
931293071 2:60894088-60894110 ATCTGTTTTCTCATGTTCTATGG + Intronic
931450634 2:62365025-62365047 ATCTCTTTTGACAACTGAGAGGG + Intergenic
931766218 2:65458906-65458928 CTCTGTTTTCTCATCTTCTAAGG - Intergenic
936040865 2:109148237-109148259 ATCTGTTTTCTCTTGTGAGATGG + Intronic
937689416 2:124737839-124737861 CTTTGTTTTCTCATCTGCAAAGG + Intronic
938745591 2:134275286-134275308 TTCTGTTTTGTTATTTGCAATGG + Intronic
941173468 2:162168319-162168341 ATCTTGTTTGTCATGTGTGAAGG + Intergenic
942334783 2:174871600-174871622 ATCAGTTTTCTCATCTACAAAGG + Intronic
943976299 2:194483168-194483190 TTGTCTTTTGTCATCTGGGAAGG - Intergenic
944350484 2:198720808-198720830 CTCTTTTTTGTCAGCTGAGAAGG + Intergenic
944987432 2:205193560-205193582 ATCATTTTTGTCATCTATGATGG - Intronic
1170267713 20:14486336-14486358 ATCTCTCCTGTCATCTGCCAGGG + Intronic
1170576705 20:17668578-17668600 ATCTGTTTTGTCCTGGGCAAGGG - Intronic
1170638752 20:18133065-18133087 ATGTGCTTTGTCAGCTGAGAGGG + Intergenic
1174651633 20:52130531-52130553 ATCTGTTTTCTCTTATGAGAAGG + Intronic
1176335577 21:5594967-5594989 ATCTGTTTGGTTATCTACAATGG - Intergenic
1176392180 21:6225981-6226003 ATCTGTTTGGTTATCTACAATGG + Intergenic
1176405808 21:6363516-6363538 ATCTGTTTGGTTATCTACAATGG - Intergenic
1176469239 21:7090193-7090215 ATCTGTTTGGTTATCTACAATGG - Intergenic
1176492800 21:7471971-7471993 ATCTGTTTGGTTATCTACAATGG - Intergenic
1176507842 21:7666412-7666434 ATCTGTTTGGTTATCTACAATGG + Intergenic
1178212843 21:30557578-30557600 ATCTGATTTGTCACCTGCAGAGG + Intronic
1179914292 21:44466587-44466609 ATTTGTTTTGACAACTGCCATGG - Intergenic
1182759978 22:32714514-32714536 TTCAGTCTTGTCATCTGCTATGG - Intronic
950411913 3:12844135-12844157 ATCAGTTTTGTCATCTGAAAGGG + Intronic
951329399 3:21347839-21347861 CACTGTTTTGTCAATTGCGAAGG - Intergenic
954616454 3:51971177-51971199 CTCTGTTTCCTCATCTGCAATGG - Intronic
959268324 3:104171880-104171902 TTCTGTTTCCTCATCTGTGAAGG + Intergenic
960547431 3:118932157-118932179 AACTGTTTTCTCTTCTGCAAAGG + Intronic
960666321 3:120112379-120112401 ACCTGTTTTCTCATCTGTCAAGG + Intergenic
961717041 3:128864828-128864850 ATCAGTTTTGTCATCTGAAAGGG - Intergenic
962876704 3:139540782-139540804 ATCTCCTTTGTCACCTGCGTGGG + Intergenic
966270760 3:178102580-178102602 ATGTGTTTTTTCATCAGTGAAGG - Intergenic
966378056 3:179317197-179317219 ATCTGTTTCTTCATATGCTATGG + Intergenic
967286359 3:187874489-187874511 ATCTGTTTTATCATTTGCAAAGG - Intergenic
970109853 4:12625528-12625550 CTTTGTATTGTCATCTGTGATGG + Intergenic
983516661 4:168664392-168664414 ATCTATTTAGTCATCTGAAATGG + Intronic
987272270 5:16323661-16323683 CTCAGTTTTCTCATCTGCAAAGG - Intergenic
988117031 5:26908137-26908159 CTCTGTTTTCTCAACTGTGATGG + Intronic
993493516 5:88581399-88581421 TGCTGTTTTCTCATCTGCAAAGG + Intergenic
995329510 5:110931708-110931730 ATGTGTTTTGGCATGTGAGATGG + Intergenic
995673585 5:114635954-114635976 CTCAGTTTTCTCATCTGTGAAGG - Intergenic
998565845 5:143215123-143215145 TTCTGGTTTGTCTTCTGCAAGGG - Intronic
1006627385 6:35406966-35406988 GTCACTTTTGTCATCTGCAAGGG + Intronic
1007561263 6:42810165-42810187 ATTTATTTTGTCATCAGCTAGGG - Intronic
1008293784 6:49752520-49752542 ATCCGTTTTGTCATCTCTAATGG + Intergenic
1014269897 6:119325176-119325198 CTCAGTTTTGTCATCTGTTAAGG - Intronic
1016533148 6:145080592-145080614 ATCTGTTCTATTATCTGAGAGGG - Intergenic
1017663275 6:156694617-156694639 ATCTGTTTATTCATCTGCCATGG - Intergenic
1018772482 6:166983873-166983895 ATATGTTTTGACATCTGATAGGG - Intergenic
1020472678 7:8556923-8556945 ATCTGTTTCTTCATCTGGAATGG - Intronic
1021631310 7:22650180-22650202 ATCTGGTTTGTCATCTTCCTTGG - Intergenic
1023191061 7:37583577-37583599 ATTTGTATTGTCATTTGTGAAGG - Intergenic
1025592182 7:62875475-62875497 AACTGTTGTAGCATCTGCGAAGG + Intergenic
1025888841 7:65625767-65625789 GCCTGTTTTGTCATCTCAGATGG - Intergenic
1026696863 7:72602466-72602488 CTCTGCTTTGTCAGCTGAGAGGG + Intronic
1030751054 7:113233382-113233404 ATCTGTTTTGACATCTCCAGTGG + Intergenic
1031147689 7:118015192-118015214 ATCCATTTTGTCATCTGAAAAGG + Intergenic
1031853611 7:126896203-126896225 GCCTGTTTTGTCATCTCAGATGG + Intronic
1032997446 7:137463808-137463830 ATCAGTTTTCTCATCTGTGAAGG - Intronic
1043268506 8:78299071-78299093 ATTTGTTCTGTCAGCTGAGAGGG + Intergenic
1045570383 8:103362900-103362922 TTCTGTTCTGTCATCTTCAATGG - Intergenic
1047212473 8:122850967-122850989 ACCTGTTTTGGCATTTGCGCTGG + Intronic
1049143454 8:140979435-140979457 ATCTGTTTTGTCTTCTGTGAAGG - Intronic
1049273238 8:141707246-141707268 ATCTGCTGTGTCCTCTGGGAAGG + Intergenic
1056096776 9:83262780-83262802 ATGTGTTATGTCCTCTGGGAAGG + Intronic
1056644229 9:88396595-88396617 TTCTGTTTTGTTTTCTGAGACGG - Intronic
1060157530 9:121330123-121330145 ATCTGTTTGTTCATCTGTTAGGG + Intronic
1060700109 9:125743826-125743848 TTCTGTTCTGTCATCTGTGAAGG + Intergenic
1061524093 9:131143703-131143725 ATCTTATTTGTCATTTGCTATGG + Intronic
1203426063 Un_GL000195v1:39935-39957 ATCTGTTTGGTTATCTACAATGG + Intergenic
1187151785 X:16687774-16687796 ATCTGATTAGTCATCTACCAAGG + Intronic
1189638240 X:43036310-43036332 AACTGTTTTGTCAAATGCCAAGG - Intergenic
1190280438 X:48925742-48925764 AGCAGTTTTGACATCTGGGAGGG - Intronic
1191758863 X:64625251-64625273 ATCTCTTTTTTCATTTGCAAAGG - Intergenic
1194782350 X:98039685-98039707 ATCTGTTTTGTCAGCAGGGAGGG + Intergenic
1194912106 X:99658218-99658240 TTCTGTTTTTTCCTCTGAGATGG - Intergenic
1195749860 X:108152957-108152979 AACTGTTTTGTCATCTCCCCAGG + Exonic
1196170392 X:112581044-112581066 AAATGATTTGTCATCTGCAAGGG + Intergenic
1200251199 X:154554951-154554973 ATCAGTTTTGTCACCTCAGATGG + Intronic