ID: 1074768178

View in Genome Browser
Species Human (GRCh38)
Location 10:116715996-116716018
Sequence CATCTGTTTTGTCATCTGCG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 157
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 149}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1074768178_1074768182 9 Left 1074768178 10:116715996-116716018 CCTCGCAGATGACAAAACAGATG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1074768182 10:116716028-116716050 CAGCTGAGCAGCTCCCACTCTGG No data
1074768178_1074768184 14 Left 1074768178 10:116715996-116716018 CCTCGCAGATGACAAAACAGATG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1074768184 10:116716033-116716055 GAGCAGCTCCCACTCTGGGATGG No data
1074768178_1074768183 10 Left 1074768178 10:116715996-116716018 CCTCGCAGATGACAAAACAGATG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1074768183 10:116716029-116716051 AGCTGAGCAGCTCCCACTCTGGG No data
1074768178_1074768185 15 Left 1074768178 10:116715996-116716018 CCTCGCAGATGACAAAACAGATG 0: 1
1: 0
2: 0
3: 7
4: 149
Right 1074768185 10:116716034-116716056 AGCAGCTCCCACTCTGGGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1074768178 Original CRISPR CATCTGTTTTGTCATCTGCG AGG (reversed) Intronic
901132902 1:6973703-6973725 CTTTGGTTTTGTCATCTGCTGGG + Intronic
901182670 1:7352304-7352326 CGTCACTTTTGTCATCTGGGAGG + Intronic
902715889 1:18272410-18272432 CTTCAGTTTCCTCATCTGCGTGG + Intronic
909037207 1:70607410-70607432 CATCTGTTTTGTGGTCTGGTTGG - Intergenic
909730098 1:78879160-78879182 CATCTGTTTGGTAATGTGTGCGG - Intergenic
912245078 1:107953400-107953422 AATCTGTTTTCTCATCTGATAGG - Intronic
913965411 1:143373162-143373184 AACCTGTTTTGTCATCAGTGGGG + Intergenic
914059785 1:144198764-144198786 AACCTGTTTTGTCATCAGTGGGG + Intergenic
914119365 1:144767607-144767629 AACCTGTTTTGTCATCAGTGGGG - Intergenic
915577131 1:156786849-156786871 GATCTGCTTTGTCACCTGCAGGG - Exonic
916168513 1:161983884-161983906 CAACTGCTTCGTCATCTGTGGGG - Exonic
916750470 1:167719108-167719130 TATCTGATTTGTTATCTGCGAGG + Intergenic
917941634 1:179928057-179928079 AATTTGTTTTGCCATCTGCTGGG + Intergenic
918496609 1:185146061-185146083 CATCTGTTATGTCTGCTGGGTGG - Intronic
919201968 1:194366710-194366732 CATCTGTTTAGTCATATGGATGG + Intergenic
919887780 1:201947377-201947399 CATCTGTTTCTTCCTCTGCCGGG + Intergenic
919951397 1:202367577-202367599 CATCTGTTTTTCCTTCTGCCTGG + Intronic
922369121 1:224891919-224891941 CATCTGTTTGGTAATGTGTGTGG - Intergenic
923142867 1:231175951-231175973 GATCTGTATTGTCATCTGTCAGG + Intronic
923795556 1:237151589-237151611 CTTCAGTTTTCTCATCTGCTGGG + Intronic
1064456040 10:15488333-15488355 CCTCAGTTTTGTCATCTGTAAGG + Intergenic
1069032113 10:63608014-63608036 CATGTCATTTGTCATCTGTGTGG + Intronic
1073733642 10:106320750-106320772 CTTCTTTCTTGTCATCTGCAAGG - Intergenic
1074768178 10:116715996-116716018 CATCTGTTTTGTCATCTGCGAGG - Intronic
1083163265 11:60868514-60868536 CCTCTGTTTCCTCATCTGCAAGG + Intronic
1084150820 11:67287158-67287180 TATCTGTTTAGTCACCCGCGGGG - Intergenic
1087710600 11:101545390-101545412 CATATATTTTGCTATCTGCGTGG + Intronic
1089875875 11:121722096-121722118 CATGCATTTTGTCATCAGCGTGG + Intergenic
1091292372 11:134448373-134448395 CACCTGTATTGTCCTCTGGGTGG - Intergenic
1091347242 11:134863714-134863736 CATCCTATTTGTCCTCTGCGAGG + Intergenic
1093024727 12:14235305-14235327 CATCTGTTTGGTAATGTGTGTGG - Intergenic
1095961800 12:47839568-47839590 CATCCTTCTTGTCATCTGCAGGG + Intergenic
1098458784 12:70708238-70708260 CAACACTTTTGGCATCTGCGTGG + Intronic
1099513427 12:83566072-83566094 CATCTGTTCTTTCATCAGCATGG - Intergenic
1100040616 12:90313020-90313042 CCTCTGTTTCCTCATCTGTGAGG + Intergenic
1100584948 12:95970880-95970902 CATCTGATTTTTCATCTAGGAGG + Intergenic
1101833276 12:108275954-108275976 CATTTGCTTTGTTATCTCCGGGG - Intergenic
1112398447 13:99054870-99054892 CATCTTTTTTGTCTTCTCTGTGG - Intronic
1113063463 13:106350035-106350057 AATCTGTTTTGTCTTCTGCTAGG - Intergenic
1114143867 14:19949656-19949678 CATGGGTTTTGGTATCTGCGGGG - Intergenic
1114261527 14:21040209-21040231 CTTCTGGTTTGTCCTCAGCGAGG - Intronic
1114315230 14:21503663-21503685 CATCTGTCTTGCCATCTCCACGG - Exonic
1115569489 14:34653257-34653279 CATCTGTTTGGTAATGTGTGTGG - Intergenic
1118496418 14:66312141-66312163 CCACTGATTTGTCATTTGCGGGG - Intergenic
1120113096 14:80581501-80581523 AATCAGTTCTGTCATCTGCCAGG - Intronic
1121018824 14:90566607-90566629 CCTCCGTTTTCTCATCTGTGTGG - Intronic
1125212304 15:37231684-37231706 CATTTGTTATTTCATCTGCCTGG - Intergenic
1126698094 15:51342219-51342241 AGTCTGTTTTCTCATCTGTGAGG + Intronic
1130143226 15:81250547-81250569 CATATGTTTTGTCATCTTGTGGG + Intronic
1142112913 16:88341666-88341688 TCTCGGTTTTGCCATCTGCGGGG + Intergenic
1144720599 17:17467009-17467031 ATTTTGTTTTGTCATCTGTGTGG + Intergenic
1146553951 17:33807020-33807042 CATCTGCTTTGTCATTAGCTCGG + Intronic
1149301221 17:55305888-55305910 TCTCTGTTTTTCCATCTGCGTGG + Intronic
1150367817 17:64606108-64606130 CATCTGCTTTGGAATCTGAGAGG + Intronic
1151137924 17:71965575-71965597 CATCTGTTGTTTCCTCTGCATGG - Intergenic
1152454602 17:80406448-80406470 CATCTGTTTGGTAATGTGTGTGG - Intergenic
1152985449 18:316584-316606 GATCAGTTTCGTCATCTGCTTGG + Intergenic
1154305664 18:13229064-13229086 CTTCTGTTCTGCCATCTGCATGG + Intronic
1154461829 18:14597700-14597722 CATGGGTTTTGGTATCTGCGGGG - Intergenic
1159386294 18:67729441-67729463 CATAGATTTTGTCATCTGTGGGG - Intergenic
1164856471 19:31528476-31528498 CATCTGTTATGGCATCTGCATGG - Intergenic
1166399063 19:42464639-42464661 CATCTGTATTGGGATCTTCGAGG + Intergenic
1166606351 19:44146628-44146650 CATCTTTTTTGGCACCTGTGTGG - Intronic
1202699190 1_KI270712v1_random:150650-150672 AACCTGTTTTGTCATCAGTGGGG + Intergenic
925832177 2:7906703-7906725 CTTCAGTTTTCTCATCTACGAGG - Intergenic
926822536 2:16868525-16868547 CATATGTTTTGTAATCTTTGTGG + Intergenic
928289143 2:30022302-30022324 CCTCCATTTTCTCATCTGCGGGG - Intergenic
931580437 2:63765785-63765807 CATGTGTTTGTTCATCTGCATGG + Intronic
933885427 2:86715360-86715382 CATCTTTTATGTCACCTGTGTGG - Intronic
933924749 2:87081331-87081353 CATCTTTTATGTCACCTGTGTGG + Intergenic
933933133 2:87175860-87175882 CATCTATTTTGGCATGTGCATGG - Intergenic
934170139 2:89534135-89534157 AACCTGTTTTGTCATCAGTGGGG + Intergenic
934280441 2:91608443-91608465 AACCTGTTTTGTCATCAGTGGGG + Intergenic
934971578 2:98768623-98768645 CATCTGTCTTCTCATCTCCAAGG + Intergenic
935374887 2:102385976-102385998 CATCTGTTTTGTCCTCTCAATGG + Intronic
935467109 2:103411469-103411491 CATCAGTTATCTCATCTCCGAGG - Intergenic
936359980 2:111789587-111789609 CATCTATTTTGGCATGTGCATGG + Intronic
940313655 2:152305285-152305307 CATCAGTTTCCTCATCTGCAAGG + Intergenic
940662774 2:156568211-156568233 CATCTGTTTTCTGATCTGTATGG + Intronic
940726759 2:157343675-157343697 CATCTGTTTGGTAATGTGTGTGG - Intergenic
943230853 2:185249388-185249410 CTTCTGTTTTGTTCTCTGAGTGG + Intergenic
945003361 2:205376172-205376194 AACCTGTTTTTTCATCTGTGAGG - Intronic
945692954 2:213064739-213064761 CATCTGTTTTTGCATCTTCTTGG + Intronic
1169045029 20:2528318-2528340 CCTCCGTTTTTTCATCTGCTGGG - Intergenic
1170226959 20:14001664-14001686 CATCTGTTAGGTCTTCTGGGAGG + Intronic
1174310335 20:49648342-49648364 CCTCTGTTTTGCCATCTCTGGGG + Intronic
1175948227 20:62568571-62568593 CATCTGTCTTTTCATCTCCCTGG + Intronic
1179657802 21:42856013-42856035 CATTGGCTTTGTCATCTGCCTGG - Intronic
1182432801 22:30310339-30310361 CATCTCTTTTCTCATCTGACTGG + Intronic
1184266748 22:43351360-43351382 CATCTGTGTTCTGATCTGCCAGG - Intergenic
1184388568 22:44190029-44190051 CCTCAGTTTTCTCATCTGGGTGG - Intronic
1184833637 22:47007350-47007372 CAGCTGCCTTTTCATCTGCGTGG - Intronic
950411912 3:12844134-12844156 CATCAGTTTTGTCATCTGAAAGG + Intronic
950446938 3:13043900-13043922 CCTCTGTTTCCTCATCTGAGGGG - Intronic
952297538 3:32074443-32074465 CATCTGTTTGGTAATGTGTGTGG - Intronic
952668363 3:35935499-35935521 CTTCTGTTTCTTCATCTGCATGG - Intergenic
953658387 3:44872013-44872035 CCTCTGTTTCTTCATCTGGGAGG - Intronic
956916247 3:73874614-73874636 CATCAGTATTGTCATTTGGGTGG - Intergenic
961437628 3:126930533-126930555 CATTTGTTCTGTCTTCTGGGAGG + Intronic
961717042 3:128864829-128864851 AATCAGTTTTGTCATCTGAAAGG - Intergenic
961807580 3:129500406-129500428 CTTCTGTTTCATCATCTGCAAGG - Intronic
962876703 3:139540781-139540803 CATCTCCTTTGTCACCTGCGTGG + Intergenic
963384187 3:144569686-144569708 CATCTTTTTTGTCATCTTCATGG - Intergenic
967095098 3:186171419-186171441 CATCTGTTTTGGTATTTGCAGGG - Intronic
967563360 3:190944076-190944098 CATCTGATATATCATCTGCCTGG - Intergenic
969243931 4:5920288-5920310 GATCTGTTTTTACATCTGTGAGG + Intronic
969422165 4:7103753-7103775 CAGCTGTCCAGTCATCTGCGTGG - Intergenic
969465522 4:7354107-7354129 CTTCTGTTTTGTTCTCTGCACGG + Intronic
971052598 4:22877905-22877927 CATCTCTTTTGCCATCGGCCAGG + Intergenic
974199973 4:58624343-58624365 CATTTGTTTTCTCATCTTTGTGG - Intergenic
975056149 4:69932163-69932185 AATCTGATTTGTCATCTAGGAGG + Intronic
976644026 4:87368693-87368715 AACCTGTTTTATCATCAGCGAGG - Intronic
977748384 4:100579201-100579223 CATATGTTTAGTAATCTGAGAGG + Intronic
978697364 4:111597984-111598006 CATCTGTTTGGTCTGCTGCTTGG + Intergenic
981139860 4:141255192-141255214 CATCTGTGTGGTCATCTGTGAGG + Intergenic
983446326 4:167857940-167857962 CACCCGTCTTGTCTTCTGCGTGG - Intergenic
983951777 4:173650556-173650578 CAACTTTTTAGTCATCTGCTGGG - Intergenic
984197377 4:176675389-176675411 CATCAGTTTTATCTTCTGCTTGG + Intergenic
997850404 5:137327699-137327721 CCTCTGTTTCCTCATCTGCAAGG + Intronic
998665014 5:144287279-144287301 CCTGTGTTTTGTCATCAGTGGGG + Intronic
999618210 5:153447862-153447884 CATTTGTTTTCTGATCTGCTTGG + Intergenic
1003309391 6:4956271-4956293 CTTCTGTTTTGTGCCCTGCGTGG + Intergenic
1006684822 6:35823924-35823946 CATGTATTTTGGCATCTGCAGGG - Exonic
1007561264 6:42810166-42810188 CATTTATTTTGTCATCAGCTAGG - Intronic
1012593402 6:101011275-101011297 CATCCGTTTTGTGAACTGCCTGG + Intergenic
1016835101 6:148469240-148469262 CCTCAGTTTTCTCATCTGCTAGG + Intronic
1017566620 6:155693924-155693946 CATTTGTTTTGTAAGCGGCGGGG - Intergenic
1017922150 6:158882113-158882135 CATCTGTTTGGTTATGTGTGTGG + Intronic
1018184625 6:161255923-161255945 CTTATGTTTTGTCTTCTGTGGGG - Intronic
1019920939 7:4163045-4163067 CATCTGTTGTGTCTGCTGCCAGG - Intronic
1021839338 7:24709836-24709858 CATCTGTTTTGTTATATTCTGGG - Intronic
1023694238 7:42828438-42828460 CATCTGTGCTGGCTTCTGCGAGG - Intergenic
1026825069 7:73576569-73576591 CATCTGTTGAGTCCTGTGCGGGG + Intronic
1033720286 7:144051485-144051507 CATGTGCTTTGTGATCTGCATGG - Intergenic
1037564516 8:20106191-20106213 CCACTGTTTTGTCATCTCCATGG - Intergenic
1039113725 8:34068753-34068775 TATCTTTTTTGTCATATGTGTGG + Intergenic
1043820172 8:84853897-84853919 AATCTGTTATGTCCTCTGGGAGG + Intronic
1044859769 8:96511557-96511579 CAGCTGTTTTGGCTTCTGCCTGG + Intronic
1046036233 8:108844662-108844684 CATCTGTTTTGTCATACACAGGG - Intergenic
1046918419 8:119701566-119701588 CATCTGTTTTGCCTTAAGCGTGG - Intergenic
1048369050 8:133761081-133761103 CATCTGTTTATTCCTCTGGGTGG - Intergenic
1050853514 9:10320454-10320476 CAACTGCTTTGTCATGTGCTTGG + Intronic
1052416660 9:28186734-28186756 CATCTGTTCTTTCCTCTGCCTGG - Intronic
1056859411 9:90166083-90166105 CATCTGGTTTGGCATTTGCTGGG + Intergenic
1056975097 9:91245739-91245761 CCTCCGTTTTCTCATCTGTGTGG - Intronic
1058163987 9:101599967-101599989 CATCAGGTTTGTCATCTGTTTGG + Intronic
1059407350 9:114109432-114109454 CATCTGGCTTTTCCTCTGCGTGG - Intergenic
1062268398 9:135697870-135697892 AAACTGTGTTGTCATCTGTGAGG - Intronic
1190730292 X:53221390-53221412 AACCTGTTTTCTCATCTGTGAGG + Intronic
1193230209 X:79035406-79035428 CATCTGTTTTGTGAGCTATGGGG + Intergenic
1193349329 X:80441352-80441374 CATCTTATTTGACATCTACGTGG - Intronic
1193427306 X:81355235-81355257 CTTCTATTGTCTCATCTGCGAGG + Intergenic
1193543508 X:82799448-82799470 CATCTGTTTTTTCATATGATTGG + Intergenic
1194782349 X:98039684-98039706 AATCTGTTTTGTCAGCAGGGAGG + Intergenic
1197330044 X:125142447-125142469 CATCTGCTTTGCCTTCTGCTAGG - Intergenic
1200254805 X:154574721-154574743 CAGTTGTTCTGTCATCTGTGTGG - Intergenic
1200262964 X:154629687-154629709 CAGTTGTTCTGTCATCTGTGTGG + Intergenic